Species of Colletotrichum associated with citrus trees in Iran

Document Type : Original Article

Authors

1 Department of Plant Protection, Faculty of Agriculture, University of Guilan, Rasht, Iran

2 Department of Plant Protection, College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran

3 Plant Protection Research Department, Citrus and Subtropical Fruits Research Center, Horticultural Sciences Research Institute, Agricultural Research, Education and Extension Organization (AREEO), Ramsar, Iran

Abstract

Colletotrichum species are associated with citrus plants as pathogens, saprobes and endophytes. According to the most recent multigene phylogenetic analysis, a lot of changes were happened in the taxonomy and species delimitation in the genus Colletotrichum. In this investigation, 292 Colletotrichum isolates were obtained from leaves, fruits and stems of Citrus species at Golestan, Mazandaran, Guilan and Kerman provinces. After morphological studies, a multilocus molecular phylogenetic analysis (TUB2, CHS–1, CAL) of 13 isolates were carried out. Based on the morphological and molecular data, five species including C. gloeosporioides s. s., C. fructicola and C. siamense (from C. gloeosporioides s. l.); C. karstii and C. novae zelandiae(from C. boninense s. l.) were identified. According to our knowledge, this is the first report of C. novae–zelandiae from Iran and C. siamense and C. karstii from citrus plants in the country.

Keywords

Main Subjects


INTRODUCTION

Iran, with 276,000 hectares of cultivation area and annual production of 4.293 million tons of citrus fruit is among the top ten countries in the world in citrus production (Anonymous, 2014). SeveralColletotrichum species cause anthracnose disease in many plants in tropical, subtropical and temperate areas (Jeffries et al. 1990; Bailey & Jeger 1992; Dodd et al. 1992; Freeman et al. 1998; Latunde–Dada, 2001; Wharton & Dieguez–Uribeondo 2004; Peres et al. 2005).

Colletotrichum gloeosporioides is one the most important species, which is regarded as the causal agent of anthracnose for many agriculturally important crops. However, for many years, C. gloeosporioides was considered as a complex species (Weir et al. 2012).

Colletotrichum acutatum (Damm et al. 2012 a) and C. boninense (Damm et al. 2012 b) are other important species complexes which cause plant diseases. For many years, identification and species delimitation were based on the morphological characters, such as shape and size of conidia and appressoria, color of colony, presence or absence of setae and teleomorph, host species and growth rate of hyphae on medium (Weir et al. 2012). These characters can vary in different media and cultural conditions, or be absent in subcultures (Weir et al. 2012). Recently, according to the molecular findings, especially the multi–gene phylogenetic analysis, classification, taxonomic placement and species concepts in Colletotrichum were changed (Cannon et al. 2012; Damm et al. 2012b; Weir et al., 2012).

Many genes and genomic regions such as actin (ACT), calmodulin (CAL), chitin synthase (CHS–1), glyceraldehyde–3–phosphate dehydrogenase (GAPDH), ribosomal internal transcribed spacer (ITS), glutamine synthase (GS), manganese superoxide dismutase (SOD2), β–tubulin 2 (TUB2) and histone3 (HIS3) have been used for revision and taxonomic treatment of some species complexes of Colletotrichum (Damm et al. 2012 a, b; Weir et al. 2012). Recent studies have led to the introduction of new species isolated from citrus. In Guizhou and Yunnan provinces in China, C. boninense, C. brevispora, C. fructicola, C. gloeosporioides, C. karstii, C. simmondsii and C. murrayae were isolated from citrus leaves (Peng et al. 2012). Also, C. gloeosporioides, C. fructicola, C. karstii, C. citricola and C. citri were reported from citrus in China (Huang et al. 2013).

Citrus anthracnose is a common disease of citrus in the north of Iran. Initially, C. gloeosporioides as the causal agent of disease was reported by Petrak & Esfandiari (1941)  from coastal areas of Caspian Sea in the north, and in 1995 from citrus orchards in the south of Iran (Ershad 2009).

In Iran, based on multi–gene phylogenetic analyses of internal transcribed spacer (ITS), beta tubulin (TUB), histone H3 (HIS), calmodulin (CAL), and actin (ACT) loci, C. fructicola was reported from Citrus sinensis (Arzanlou et al. 2015).

During the recent years, several researchers have addressed some aspects of etiology and distribution (Babri et al. 2008), pathogenicity (Babri et al. 2009; Davarian et al. 2006) and vegetative compatibility groups of C. gloeosporioides (Khansari Atigh et al. 2010), relative susceptibility of some citrus cultivars to C. gloeosporioides (Babri et al. 2007), sexual fertility, mating type and genetic diversity of Glomerella cingulata by rep–PCR (Behnia et al. 2016) in Iran. However, identification of Colletotrichum species in these studies has been based on the morphological characteristics. Due to the high morphological similarity of these fungal isolates on citrus plants, identification of such species solely based on morphological characters have often been inadequate (Brown et al., 1996), and such species are considered as C. gloeosporioides complexspecies.

The main objective of this study was to reconstruct phylogenetic relationships and improve the current species concept of Colletotrichum on citrus plants based on morphological and molecular characteristics in Iran.

 

MATERIALS AND METHODS

Sampling, isolation and culture

During 2013–14, symptomatic tissues of different citrus varieties including leaves, fruits and stems were collected from Golestan, Mazandaran and Guilan provinces (north of Iran) and Kerman province (south of Iran). Samples were cultured on potato dextrose agar (PDA) medium. Plates were incubated in the dark at 25°C. Isolates were purified by single spore method (Ho & Ko 1997). From 428 samples, 292 Colletotrichum isolates were obtained.

 

ISSR fingerprinting for preliminary screening

Due to the huge number of isolates, we used ISSR fingerprinting for preliminary screening of isolates.

DNA extraction

DNA extraction was conducted according to the rapid minipreparation method (Liu et al. 2000) with a little modification. 50–100 mg mycelia of the seven–day–old monosporic colony were surface scraped by scalpel blade, placed in a 1.5 ml tube and ground by a close–ended tip in liquid nitrogen. 500 μL of extraction buffer (400 mM Tris, pH 8; 60 mM EDTA, pH 8; 15 mM NaCl; SDS 1%) was added to each tube. After 10 minutes at room temperature, 150 μL of potassium acetate buffer, pH 4.8 (60 mL potassium acetate 5 M, 11.5 mL acetic acid, 28.5 mL deionized water) was added to the tube and vortexed briefly. After two times of centrifugation with 13000 rpm for 1 minute with replacing the liquid phase in each time, an equal volume of chloroform was added, and centrifuged at 13000 rpm for 5 min. Supernatant was recovered carefully. Nucleic acid was precipitated by addition of the same volume of cold isopropyl alcohol and centrifuged at 13000 rpm for 2 min. The pellet was dried by using a vacuum pomp, and after adding 300 μL of cold ethanol 70% was recentrifuged at 13000 rpm for 1 min. Aquatic phase was removed and after drying, the pellet was dissolved in 50 μL distilled water. 

PCR amplification

PCRs were performed in an MJ research thermal cycler using five ISSR primers (table 1). PCR was carried out in 12 μL reactions, containing 6 μL of 2X PCR Master Mix (Topaz Gene Research), 1 μL (10 pM) of each forward and reverse primers (table 2) and 75 ng DNA, using cycling parameters as: initial denaturation at 94 °C for 5 min, 40 cycles of denaturation at 94 °C for 30 s, annealing at 50 °C for 45 s and extension at 72 °C for 2 min, followed by final extension at 72 °C for 7 min.

Products were loaded on 1% (w/v) agarose gel containing 1×TBE (45 mM Tris–borate, 1 mM EDTA) and 0.5 μg/ml aqueous solution of ethidium bromide. PCR products were separated through electrophoresis at constant voltage of 110 V for 2 h. DNA fragments were visualized and documented with UV doc system (EBOX VX5/20, Vilber Loumat, France), and size of the PCR products was determined by comparison with the migration of GeneRuler 100 bp DNA Ladder (Viogene).

Data analysis

Amplified fragments were scored as present (1) or absent (0). The ISSR–PCR fragment profiles were subjected to cluster analysis to produce a dendrogram based on Jaccard’s similarity coefficient by Un–weighted Pair Group Method (UPGMA) using NTSYSver2.02 software (Rohlf, 1998).

 

Table 1. Primers were used for preliminary screening of Colletotrichum isolates.

ISSR Primers

Sequence (5′–3′)*

References

ISSR3

HVHTGTGTGTGTGTGTGT

Fang.and Roose, 1997

ISSR4

ACACACACACACACACYA

Nourollahi and Shahbazi, 2015

ISSR5

GAGAGAGAGAGAGAGAYG

Malekzadeh et al., 2011

ISSR7

AGAGAGAGAGAGAGAGYC

Wang et al., 2005

ISSR9

AGAGAGAGAGAGAGAGC

Bagherabadi et al., 2015

* Y= pyrimidine, H= non–G, V= non–T

 

Phylogenetic study

A part of β–tubulin 2 (TUB2), chitin synthase (CHS–1) and calmodulin (CAL) genes were amplified by using primers shown in table 2. Samples were run in 25 μL reactions using 12 μL of 2X PCR Master Mix (Topaz Gene Research), 1 μL (10 pM) of each forward and reverse primers (table 3) and 75 ng DNA. Cycling program conditions were as follows: initial denaturation at 95 °C for 4 min, 35 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for TUB, 58 °C for CHS–1 and CAL genes for 30 s and extension at 72 °C for 45 s, followed by final extension at 72 °C for 7 min. Single DNA bands of the expected size of TUB2 gene and PCR products of CHS–1 and CAL genes were purified with the QIAquick PCR purification kit (QIAGEN) and sequenced in both forward and reverse directions by Bioneer company (SK, Seol).

Sequences of the TUB2, CHS–1 and CAL genes were compared by BLAST search against related sequences retrieved from GenBank and were aligned using MEGA 5 (Tamura et al. 2011). Gaps were treated as missing data. The data were analyzed using Maximum Likelihood (ML) method with Tamura-Nei distance model and bootstrap values of 1000 replicates in MEGA 5.0 software. The sequence of Colletotrichum truncatum OOC72 (obtained from GenBank) was used as outgroup.

 

Morphological study

Morpholgical characteristics such as color of the colony, mycelial growth and presence or absence of setae in each isolate were investigated. Slide culture technique was used to produce appressoria. Spores were placed on drops of sterile water on a microscope slide in Petri dishes and incubated at 25°C in the dark or light condition. After 24–48 hours, the shape and color of appressoria were studied (Johnston and Jones 1997). Size of 50, seven–day–old conidia on PDA were measured and their shape were studied (Sutton 1992) by light microscopy (Nikon Eclipse E600 FN, Nikon, Japan).

 

Table 2. Primers were used for phylogenetic analysis of Colletotrichum isolates.

Gene

Product

Primer

Direction

Sequence (5’–3’)

Reference

TUB2

β–Tubulin 2

T1

Foward

AACATGCGTGAGATTGTAAGT

O’Donnell & Cigelnik 1997

TUB2

β–Tubulin 2

Bt2b

Reverse

ACCCTCAGTGTAGTGACCCTTGGC

O’Donnell & Cigelnik 1997

CAL

 

Calmodulin

CL1

Foward

GARTWCAAGGAGGCCTTCTC

O’Donnell et al. 2000

CAL

Calmodulin

CL2A

Reverse

TTTTTGCATCATGAGTTGGAC

O’Donnell et al. 2000

CHS–1

Chitin synthase

CHS–79F

Foward

TGGGGCAAGGATGCTTGGAAGAAG

Carbone & Kohn 1999

CHS–1

Chitin synthase

CHS–345R

Reverse

TGGAAGAACCATCTGTGAGAGTTG

Carbone & Kohn 1999

 

RESULTS

Phylogenetic relationships

Based on the preliminary screening and cluster analysis dendrogram (data not shown) and morphological characters, 13 out of 292 isolates were selected for molecular studies.

According to a partial sequence of CAL, TUB2 and CHS genes, there was 98.33– 100 percent sequence identity between the studied isolates and the ex–type or ex–epitype species including C. gloeosporioides isolate IMI 356878 (Accession No: JX009818.1 for CHS, JX010445.1 for TUB2, JX009731.1 for CAL genes), C. fructicola isolate C1315.3 (Accession No: JX009866.1 for CHS, JX010405.1 for TUB2, JX009676.1 for CAL genes), C. siamense isolate C1315.2 (Accession No: JX009865.1 for CHS, JX010404.1 for TUB2, JX009714.1 for CAL genes), C. novae zelandiae CBS:128505 (Accession No: JQ005402.1 for CHS, JQ005662.1 for TUB2, JQ005749.1 for CAL genes) and C. karstii isolate CORCG6 (Accession No: HM582023.1 for CHS, HM585428.1 for TUB2, HM582013.1 for CAL genes) (table 3).

Some authentic fungal DNA sequences which had high similarity with our isolates and ex–type or ex–epitype species of C. gloeosporioides, C. fructicola, C. siamense, C. novae–zelandiae and C. karstii, available from GenBank were aligned with our isolates and used for phylogenetic study (Table 3).

The isolates formed a monophyletic clade with the reliable reference relatives of their species from GenBank isolates (Fig. 1–3).

According to the trees derived from CHS I and Tub 2 genes, eight out of 13 isolates investigated in this study, belonging to the C. gloeosporioides complex were clustered together in a big clade (Fig. 1 and 2). On the other hand, based on the tree inferred from CAL gene, isolates 296, 382, 472, RMN and TABN were clustered with C. gloeosporioides members, supported by a bootstrap value of 99% (Fig. 3).

Isolate 283 was clustered with C. novae zelandiae clade, while isolates 288 and 339s were grouped with members of C. fructicola and C. siamense groups, respectively. The phylogenetic trees inferred from CHS I and Tub 2 genes showed that the isolates 283, 288 and 339s are C. novae–zelandiae, C. fructicola and C. siamense respectively (Fig 1, 2).

Phylogenetic analysis of the isolates 272, 296, 382, 472, RMN and TABN along with reference isolates of C. gloeosporioides allowed these isolates to be ascribed to the C. gloeosporioides s. str. (Fig. 1–3) and finally, the isolates 298, 357, 445 and 468 were grouped with members of C. karstii. Cluster analysis and phylogenetic results confirmed the BLAST data.

 

Table 3: The percent of sequence identity between a partial sequence of CAL, TUB2 and CHS genes of Colletotrichum isolates obtained from citrus in this study and ex–type or ex-epitypes of the same Colletotrichum species.

Isolate

 

Genes

  Accession No.

CHS

TUB

CAL

283 (C. novae–zelandiae)

IRAN 2575 C

98.93

99.68

 - 

288 (C. fructicola)

IRAN 2576 C

100

99.56

 - 

339s (C. siamense)

IRAN 2579 C

98.66

98.99

-

298 (C. karstii)

IRAN 2578 C

99.19

100

-

357 (C. karstii)

IRAN 2580 C

100

99.7

 - 

445 (C. karstii)

-

99.19

99.7

-

468 (C. karstii)

IRAN 2582 C

99.19

100

-

272 (C. gloeosporioides)

IRAN 2574 C

99.33

100

100

296 (C. gloeosporioides)

IRAN 2577 C

98.66

99.68

100

382 (C. gloeosporioides)

IRAN 2581 C

98.99

99.63

99.59

472 (C. gloeosporioides)

IRAN 2583 C

98.33

99.85

100

RMN (C. gloeosporioides)

IRAN 2584 C

100

99.13

99.59

TABN (C. gloeosporioides)

IRAN 2585 C

98.33

100

99.59

 

 

 

 

Fig. 1. Maximum likelihood phylogram inferred from partial Tub 2 sequence data, showing phylogenetic relationships of Colletotrichum species isolated from citrusand selected sequences of Colletotrichum species. The numbers above the branches represent branch support using1000 bootstrap replications. Colletotrichum truncatum isolate OOC72 is used as outgroup. : ex–type or ex–epitype.

 

Fig. 2. Maximum likelihood phylograms inferred from partial CHS I sequence data, showing phylogenetic relationships of Colletotrichum species isolated from citrusand selected sequences of Colletotrichum species. The numbers above the branches represent branch support using1000 bootstrap replications. Colletotrichum truncatum isolate OOC72 is used as outgroup. : ex–type or ex–epitype.

 

Morphological study

Colletotrichum fructicola Prihastuti, L. Cai & K.D. Hyde, Fungal Diversity 39: 158. 2009.

Colonies on PDA reaching 6–7 mm average growth per day at 25°C. Mycelia white and then turning to gray at the center over time. Seldom, conidia masses are seen at the center, with filter paper. Pale gray aerial mycelia abundant. Sclerotia, acervuli and setae absent. Conidia hyaline, cylindrical with obtuse to rounded ends, aseptate and smooth. 4.5–6.2 × 12.5–15 μm. appressoria ovoid or irregular. 5.3–6.8 × 8.4–11 μm. (Fig. 4)

Specimens examined. Iran, Mazandaran Province, Babol, isolated from stem of C. sinensis, 15 June 2014, H. Taheri, (IRAN 2576 C, isolate 288).

 

 

Fig. 3. Maximum likelihood phylograms inferred from partial CAL sequence data, showing phylogenetic relationships of Colletotrichum species isolated from citrusand selected sequences of Colletotrichum species. The numbers above the branches represent branch support using1000 bootstrap replications. Colletotrichum truncatum isolate OOC72 is used as outgroup. : ex–type or ex–epitype

Fig. 4. Colletotrichum fructicola. a. Colony on PDA; b. Conidia; c. Appressoria. — Scale bars = 10 μm.

 

 

Colletotrichum gloeosporioides (Penz.) Penz. & Sacc., Atti Reale Ist. Veneto Sci. Lett. Arti., Serie 6, 2: 670. 1884.

 

Colonies on PDA reaching 6.5–8.7 mm average growth per day at 25°C. Mycelia, initially white and turning to pale brownish with a few orange conidial masses. Aerial mycelia white to gray in color. Conidia hyaline, cylindrical to fusiform, aseptate, smooth, 5–7.5 × 15–17.5 μm. Appressoria brown, ovoid and sometimes clavate, 4.7–5.8 × 7.9–8.4 μm. (Fig. 5).

Specimens examined. Iran, Mazandaran Province, Sari, isolated from stem of C. sinensis, June 2014, H. Taheri, (IRAN 2581 C, isolate 382); Mazandaran Province, Ramsar, isolated from fruit of C. sinensis, 15 June 2014, H. Taheri, (IRAN 2584 C, isolate RMN).

 

Colletotrichum karstii Y.L. Yang, Zuo Y. Liu, K.D. Hyde & L. Cai, Cryptogamie Mycologie 32: 241. 2011.

Four out of 13 selected isolates were identified as C. karstii. Colonies on PDA reaching 5–6.5 mm. average growth per day at 25°C. The surface of colony varies from white to gray with orange conidia mass with entire margin, the reverse is pale orange. Orange conidiomata are seen on PDA with filter paper. Conidia hyaline, cylindrical and aseptate. Apex usaully rounded with a hilum at the base, 4–6.5 × 10–16.5 μm. Setae absent. Appresorium is pale brown in color and naviculate to ovoid shaped, 3.7–5.8 × 5.8– 11.59 μm. (Fig. 6).

Specimens examined. Iran, Mazandaran Province, Savadkuh, isolated from stem of C. aurantifolia, 6 Sept. 2013, H. Taheri, (IRAN 2582 C, isolate 468); Mazandaran Province, Galugah, isolated from stem of C. sinensis, 16 June 2014, H. Taheri, (IRAN 2578 C, isolate 298).

This is the first report of C. karstii from citrus plants in Iran.

 

 Fig. 5. Colletotrichum gloeosporioides. a.Colony on PDA; b. Conidia; c. Appressoria. — Scale bars = 10 μm.

 Fig. 6. Colletotrichum karstii. a.Colony on PDA; b. Conidia; c, d. Appressoria. — Scale bars = 10 μm.

 

Colletotrichum novae–zelandiae Damm, P.F. Cannon, Crous, P.R. Johnst. & B. Weir, Studies in Mycology 73: 25 (2012) [MB560742].

 

Colonies on PDA reaching 3.8–5.2 mm average growth per day at 25°C. Flat, with white margins, orange in color with dark gray flecks. Conidia hyaline, cylindrical, aseptate, rounded at the both ends with a hilum at the base, 5–6.5 × 13–15 μm. Conidiomata absent. Appressoria are irregular rounded and brown in color, 3.7–5.3 × 5.3–8.4 μm. Acervuli are present on PDA plates with dark brown setae. (Fig. 7).

Specimens examined. Iran, Mazandaran Province, Babol, isolated from stem of C. sinensis, 15 June 2014, H. Taheri, (IRAN 2575 C, isolate 283).

According to our knowledge, C. novae–zelandiae is a new record for mycobiota of Iran.

 

 Fig. 7. Colletotrichum novae––zelandiae. a.Colony on PDA; b. Conidia; c. Setae; d. Appressoria. — Scale bars = 10 μm.

 

Colletotrichum siamense Prihastuti, L. Cai & K.D. Hyde, Fungal Diversity 39: 98. 2009.

 

Colonies on PDA reaching 7–8.5 mm average growth per day at 25 °C. At first, they are white and then become pale pinkish with white to pale gray. Dense and cottony aerial mycelia and orange conidia mass at the center. Brown acervuli with setae and dark brown to black sclerotia on PDA plates. Conidia hyaline, cylindrical, aseptate with obtuse apex and round ended base, 6–7.5 × 13.5–15.5 μm. Appressoria ovoid to fusiform and brownish, 3.7–4.7 × 4.2–7.9 μm. (Fig. 8).

Specimens examined. Iran, Kerman Province, Jiroft, isolated from stem of C. sinensis, 6 Nov. 2013, H. Taheri, (IRAN 2579 C, isolate 339s).

This is the first report of C. siamense isolated from citrus in Iran.

 

DISCUSSION

In this study, some samples from citrus orchards were collected in Golestan, Mazandaran, Guilan and Kerman provinces. According to morphological characters and ISSR–PCR test (data not shown), 13 isolates were selected for molecular studies. A part of TUB2 (about 700bp) and CHS–1 (about 305bp) genes were amplified in all isolates, but CAL (about 750 bp) gene was amplified just in C. gloeosporioides isolates. According to the morphological characters and molecular data, five species including C. gloeosporioides, C. fructicola and C. siamense (C. gloeosporioides complex) and C. karstii and C. novae zelandiae (C. boninense complex) were identified.

Using multi genes to identify Colletotrichum species is necessary. Protein–coding genes are more useful due to more variation than ITS. For instance, ITS sequences cannot reliably separate C. siamense from C. alienum or C. fructicola. These species are best distinguished using CAL or TUB2 (Weir et al. 2012). Colletotrichum karstii can be distinguished from closely related species within the Boninense, Gigasporum, Acutatum and Gloeosporioides complexes, by using the TUB2 sequence data (Damm et al. 2012a, b). TUB2 gene sequence data could resolve the relationship of the Colletotrichum isolates, specially, in agreement with morphological characters (Alizadeh et al. 2015). We used TUB2, CAL and CHS–1 genes in this study. There is some incongruence between gene trees of C. gloeosporioides complex (Fig. 1, 2). It is due to the low levels of genetic divergence within this species complex and imply that species within the C. gloeosporioides complex are recently evolved (Silva et al. 2012; Weir et al. 2012).

Morphological identification of Colletotrichum spp. and species complexes is not a reliable method (Damm et al. 2012; Weir et al. 2012), so both morphological and molecular data were used in this study.

 

 Fig. 8. Colletotrichum siamense. a.Colony on PDA; b. Conidia; c. Setae; d. Appressoria. — Scale bars = 10 μm.

 

The first report of C. fructicola is from coffee berries from Thailand (Prihastuti et al. 2009). The next reports are from Coffea sp., Pyrus pyrifolia, Limonium sp., Malus domestica, Ficus sp., Theobroma sp. (Weir et al. 2012) , Citrus sp. (Huang et al. 2013), Citrus sinensis, Malus domestica, Gleditsia caspica, Sambucus ebulus (Arzanlou et al. 2015), Phaseolus vulgaris and Vigna unguiculata from Iran (Atghia et al. 2015). Morphological characteristics of C. fructicola such aspresence ofpale grey aerial mycelia, absence of Sclerotia, Setae and.acervuli in culture, conidium and appressorium shape were in agreement with the description provided by Prihastuti et al. (2009). Colletotrichum gloeosporioides is mainly associated with Citrus, but it has been isolated from different hosts (Weir et al. 2012). It is a species complex comprising morphologically indistinguishable, but genetically and biologically isolated species (Cai et al. 2009; Phoulivong et al. 2010).

Colletotrichum karstii is a polymorphic species in terms of sequence and is a morphologically diverse species as well (Alizadeh et al. 2015). In C. Karstii, size of the conidium has a different range: (11.5–14.5) × (5–6.5) μm (Damm et al. 2012b) or (13.5–15) × (4–5) μm (Aiello et al. 2015). Color of the upper surface of the colony varies from white to gray and pink in reverse (Velho et al. 2014) or white to gray, usually with pink conidial masses, reverse yellow to dark brown (Yang et al. 2011). These variations have been seen in other Colletotrichum species, too. During the storage period, even freshly isolated cultures may lose the ability to produce pigments or form well–differentiated acervuli, conidia or perithecia. Often, the aerial mycelia become very dense and felted (Weir et al. 2012). Colletotrichum karstii is a common and geographically diverse species, occurring on various host plants (Liu et al. 2015). It was reported from Orchidaceae hosts (Yang et al. 2011), Passiflora edulis (Alizadeh et al. 2015), Citrus plants in South Africa, New Zealand (Damm et al. 2012 b) and China (Peng et al. 2012).

Colletotrichum novae–zelandiae is only reported from New Zealand from grapefruit and Capsicum. It is morphologically indistinguishable from other species of the C. boninense species complex. (Damm et al. 2012b). According to studies by Damm et al. (2012b) on C. novae–zelandiae, teleomorph, conidiomata and chlamidospre are not observed on SNA. We also did not observe them on PDA. In phylogenetic studies with single gene, it forms a separate cluster as a sister group to a group including C. karstii, C. petchii, C. annellatum and C. phyllanthi (Damm et al. 2012b). In our study, C. novae–zelandiae is phylogenetically close to C. karstii based on TUB2 and CHS–1 genes sequence data.

A distinctive character between C. boninense and C. gloeosporioides species complexes is the presence of a prominent hilum or scar on the conidium of the first complex (Damm et al. 2012b), which was obsereved in C. karstii and C. novae–zelandiae especies.

Colletotrichum siamense was described by Prihastuti et al.(2009), Yang et al.(2009) and Wikee et al.(2011). It was originally described from coffee in Thailand, but it has a wide host range (Weir et al. 2012). Also, it was reported from Citrus reticulata Blanco cv. Shiyue Ju (Cheng et al. 2013). Morphological characteristics of C. siamense, such aspresence of conidial mass at the inoculation point, sclerotia and acervuli in culture, colony, conidium and appressorium shape were in agreement with the description provided by Prihastuti et al. (2009) and Wikee et al.(2011).

According to this research, C. novae–zelandiae is a new record for mycobiota of Iran. Citrus sp. is a new host recorded for C. siamense and C. karstii in Iran. Results indicate that the combination of morphological characters with the multigene sequence studies is necessary for an accurate identification of the Colletotrichum species.

Aiello D, Carrieri R, Guarnaccia V, Vitale A, Lahoz E, Polizzi G. 2015. Characterization and Pathogenicity of Colletotrichum gloeosporioides and C. karstii Causing Preharvest Disease on Citrus sinensis in Italy. Journal of Phytopathology 163:168–177.
Alizadeh A, Javan–Nikkhah M, Atghia O, Zare R, Fotouhifar KhB, Damm U, Stukenbrock EH. 2015. New records of Colletotrichum species for the mycobiota of Iran. Mycologia Iranica 2: 94–108.
Anonymous. 2014. Statistical Pocketbook of Agriculture. Planting area, production and yield report of horticultural fruits of Iran. Ministry of Jihad–e–Agriculture. Retrieved July 22, 2015, From: http//amar.maj.ir.
Arzanlou M, Bakhshi M, Karimi K, Torbati, M. 2015. Multigene phylogeny reveals three new records of Colletotrichum spp. and several new host records for the mycobiota of Iran. Journal of plant protection research 55: 198–211
Atghia O, Alizadeh A, Fotouhifar Kh.–B. 2015. First report of Colletotrichum fructicola as the causal agent of anthracnose on common bean and cowpea. Mycologia Iranica 2: 139–140.
Babri M, Javan–Nikkhah M, Taheri H, Alian Y. 2007. Evaluation of relative susceptibility of selective citrus cultivars to the casual agent of Anthracnose disease in Mazandaran province. Journal of Agricultural Science 40: 116–124.
Babri M, Javan–Nikkhah M, Taheri H, Alian Y. 2009. Comparing Virulence of Colletotrichum gloeosporioides Isolates the Causal Agent of Citrus Anthracnose in Mazandaran Province, Iran. Journal of Agricultural science 40: 27–34.
Babri M, Javan–Nikkhah M, Taheri H, Alian Y, Fatahi moghadam, J. 2008. Etiological study and dispersion appointment of anthracnose disease agent of citrus in Mazandaran province. Iranian Journal of Plant Pathology 44: 37–53.
Bagherabadi S, Zafari D, Soleimani MJ. 2015. Genetic diversity of Alternaria alternata isolates causing potato brown leaf spot, using ISSR markers in Iran. Journal of Plant Pathology & Microbiology 6: 1–6.
Bailey JA, Jeger MJ. 1992. Colletotrichum: biology, pathology and control. CAB International. Wallingford UK.
Behnia M, Javan–Nikkhah M, Aminian H, Razavi M, Alizadeh A. 2016. Population Structure and Sexual Fertility of Colletotrichum gloeosporioides sensu lato from Citrus in Northern Iran. Journal of Agricultural Science and Technology 18:561–573.
Brown AE, Sreenivasaprasad S, Timmer LW, 1996. Molecular characterization of slow–growing orange and key lime anthracnose strains of Colletotrichum from Citrus as C. acutatum. Phytopathology 86: 523–7.
Cai L, Hyde KD, Taylor PWJ, Weir BS, Waller J, Abang MM, Zhang JZ, Yang YL, Phoulivong S, Liu ZY, Prihastuti H, Shivas RG, McKenzie EHC, Johnston PR. 2009. A polyphasic approach for studying Colletotrichum. Fungal Diversity 39:183–204.
Cannon PF, Damm U, Johnston PR, Weir BS. 2012. Colletotrichum – current status and future directions. Studies in Mycology 73: 181–213.
Carbone I, Kohn LM. 1999. A method for designing primer sets for speciation studies in filamentous Ascomycetes. Mycologia 91: 553–556.
Cheng BP, Huang YH, Song XB, Peng AT, Ling JF, Chen X. 2013. First report of Colletotrichum siamense causing leaf drop and fruit spot of Citrus reticulata Blanco cv. Shiyue Ju in China. Plant Disease 97: 1508
Damm U, Cannon PF, Woudenberg JHC, Crous PW. 2012 a. The Colletotrichumacutatum species complex. Studies in Mycology 73: 37–113.
Damm U, Cannon PF, Woudenberg JHC, Johnston PR, Weir BS, Tan YP, Shivas RG, Crous PW. 2012 b. The Colletotrichum boninense species complex. Studies in Mycology 73: 1–36.
Davarian T, Taheri A, Razavi SI. 2006. Study on morphological and pathological characteristics of Colletotrichumgloeosporioides the causal agent of citrus anthracnose. Journal of Agricultural Sciences and National Resources 13:1–9.
Dodd JC, Estrada A, Jeger MJ. 1992. Epidemiology of Colletotrichum gloeosporioides in the tropics. In: Colletotrichum: biology, pathology and control. (JA Bailey & MJ Jeger, eds): 308–325. CAB International. Wallingford, U.K.
Ershad D. 2009. Fungi of Iran. Iranian Research Institute of Plant Protection Press, Tehran
Fang DQ, Roose ML. 1997. Identification of closely related citrus cultivars with inter–simple sequence repeat markers. Theoretical and Applied Genetics 95: 408–417.
Freeman S, Katan T, Shabi E. 1998. Characterization of Colletotrichum species responsible for anthracnose diseases of various fruits. Plant Disease 82: 596–605.
Ho WC, Ko WH 1997. A simple method for obtaining single–spore isolates of fungi. Botanical Bulletin of Academia Sinica 38: 41−44.
Huang F, Chen GQ, Hou X, Fu YS, Cai L, Hyde KD, Li HY. 2013. Colletotrichum species associated with cultivated citrus in China. Fungal Diversity 61:61–74.
Jeffries P, Dodd JC, Jeger MJ, Plumbley RA. 1990. The biology of Colletotrichum species on tropical fruit crops. Plant Pathology 39: 343–366.
Johnston PR, Jones D. 1997. Relationships among Colletotrichum isolates from fruit–rots assessed using rDNA sequences. Mycologia 89: 420–430.
Khansari Atigh M, Javan–Nikkhah M, Khodaparast SA, Babri M, Ghazanfari K. 2010. A Study on sexual fertility and a determination of vegetative compatibility groups among Glomerella cingulata isolates from citrus trees in Mazandaran province, Iran. Iranian Journal of Agricultural Science 41: 71–79.
Latunde–Dada AO. 2001. Colletotrichum: tales of forcible entry, stealth, transient confinement and breakout. Molecular Plant Pathology 2:187–198.
Liu D, Coloe S, Baird R, Pederson J. 2000. Rapid Mini–Preparation of Fungal DNA for PCR. Journal of Clinical Microbiology p. 471
Liu F, Weir S, Damm U, Crous PW, Wang Y, Liu B, Wang M, Zhang M, Cai L. 2015. Unravelling Colletotrichum species associated with Camellia: employing ApMat and GS loci to resolve species in the C. gloeosporioides complex. Persoonia 35: 63–86.
Malekzadeh K, Jalilzadeh Moghadam Shahri B, Mohsenifard, E. 2011. Use of ISSR markers for strain identification in the button Mushroom, Agaricus bisporus. Proceedings of the 7th International Conference on Mushroom Biology and Mushroom Product, Arcachon, France, 30–34.
Nourollahi K, Shahbazi M. 2015. Study on genetic structure of Pyrenophora graminea, populations the causal agent of barley leaf stripe disease using ISSR marker. Journal of Agricultural science 46: 161–177.
O’Donnell K, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. MoIecular Phylogenetics and Evolution 7: 103–116.
O’Donnell K, Nirenberg HI, Aoki T, Cigelnik E. 2000. A Multigene phylogeny of the Gibberella fujikuroi species complex: Detection of additional phylogenetically distinct species. Mycoscience 41: 61–78.
Peng LJ, Yang YL, Hyde KD, Bahkali AH, Liu ZY. 2012. Colletotrichum species on Citrus leaves in Guizhou and Yunnan provinces, China. Cryptogam Mycol 33:267–283
Peres NA., Timmer LW., Adaskaveg JE., Correll JC. 2005. Lifestyles of Colletotrichum acutatum. Plant Disease 89: 784–796.
Petrak F, Esfandiari E. 1941. Beiträge zür Kenntnis der iranischen Pilzflora. Annales Mycologici 39:204–228.
Phoulivong S, Cai L, Chen H, McKenzie EHC, Abdelsalam, K., Chukeatirote E., Hyde KD. 2010. Colletotrichum gloeosporioides is not a common pathogen on tropical fruits. Fungal Diversity 44: 33–43.
Prihastuti H, Cai L, Chen H, McKenzie EHC, Hyde KD. 2009. Characterization of Colletotrichum species associated with coffee berries in northern Thailand. Fungal Diversity 39: 89–109.
Rohlf FJ. 1998. NTSYS–pc 2.02. Numerical taxonomy and multivariate analysis system. Exeter Software: Applied Biostatistics Inc, Setauket, New York, USA.
Silva DN, Talhinas P, Várzea V, Cai L, Paulo OS, Batista D. 2012. Application of the Apn2/MAT locus to improve the systematics of the Colletotrichum gloeosporioides complex: an example from coffee (Coffea spp.) hosts. Mycologia 104: 396–409.
Sutton BC. 1992. The genus Glomerella and its anamorph Colletotrichum. In: Colletotrichum: Biology, Pathology and Control. (JA Bailey & MJ Jeger, eds): 1–26. CAB International, Wallingford, UK.Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28:2731–2739.
Velho AC, Stadnik MJ, Casanova L, Mondino P, Alaniz S. 2014. First Report of Colletotrichum karstii Causing Glomerella Leaf Spot on Apple in Santa Catarina State, Brazil Plant Disease 98: 157.
Wang S, Miao X, Zhao W, Huang B, Fan M, Li Z. 2005. Genetic diversity and population structure among strains of the entomopathogenic fungus, Beauveria bassiana, as revealed by inter-simple sequence repeats (ISSR). Mycological Research 109: 1364–1372.
Weir BS, Johnston PR, Damm U. 2012. The Colletotrichum gloeosporioides species complex. Studies in Mycology 73: 115–180.
Wharton PS, Diéguez–Uribeondo J. 2004. The biology of Colletotrichum acutatum. Anales del Jardín Botánico de Madrid 61: 3–22.
Wikee S, Cai L, Pairin N, McKenzie EHC, Su YY,  Chukeatirote E, Thi HN, Bahkali AH, Moslem MA, Abdelsalam K, Hyde KD. 2011. Colletotrichum species from Jasmine (Jasminum sambac). Fungal Diversity 46: 171–182.
Yang YL, Cai L, Yu ZN, Liu ZY, Hyde K. 2011. Colletotrichum species on Orchidaceae in southwest China. Cryptogamie Mycologie 32:229–253.
Yang YL, Liu ZY, Cai L, Hyde KD, Yu ZN, McKenzie EHC. 2009. Colletotrichum anthracnose of Amaryllidaceae. Fungal Diversity 39: 123–146.