Notes on two powdery mildew fungi (Erysiphe magnifica and E. corylacearum) from Iran

INTRODUCTION

Powdery mildew fungi are widespread plant pathogenic fungi that are easily recognizable by their appearance on the plant surface as white powdery covering the leaves, stems, flowers and fruits. These fungi are well characterized by their asexual and sexual morphs, which produce a unique kind of meristem-arthric aseptate conidia and a kind of unique ascomata named chasmothecia. More than 1000 species have been described based on solely anamorphic or teleomorphic, or both states. Powdery mildew fungi are different in host range and distribution. Some species are strictly confined to a few host plant species so that they may occur just on a few species of one genus. On the other hand, some species have been reported on hosts belonging to a large number of plant families that are distantly related to each other (Braun 1987, Palti 1988, Braun & Cook 2012). Closely related species of a single genus on a common host sometimes are hardly distinguishable. For example, Magnolia s. l. species may be infected by four powdery mildews from the same genus (Braun & Cook 2012, Cho et al. 2014). According to the literature more than 100 species of powdery mildew have been reported from Iran; probably some further species might have not been observed and are waiting to be explored for the country (Khodaparast et al. 2001, Khodaparast 2007, Khodaparast & Abbasi 2009, Abbasi et al. 2013, Sharifi et al. 2013, Khodaparast et al. 2016, Arzanlou et al. 2017).

MATERIALS AND METHODS

Morphological examination

For microscopy of hyphae, conidiophores and conidia, these structures were stripped off from the leaf surface using clear adhesive tapes and subsequently mounted in glycerol/lactic acid solution (Heidari et al. 2015, Khodaparast et al. 2016a). An Olympus light microscope (BH-2, Japan) equipped with a Sony digital camera was used for microscopic observations and photomicrography. All measurements were done based on at least 20 to 30 observations. Morphological features of the species were compared to the description and illustration of related taxa available in the literature (Shin 2000, Braun & Cook 2012, Cho et al. 2014).

DNA sequencing and data analysis

Total DNA was extracted from fungal specimens by the Chelex method (Walsh et al. 1991; Hirata & Takamatsu 1996; Khodaparast et al. 2016 a, b). Primers ITS1 (5'–TCCGTAGGTGAACCTGCGG–3') and ITS4 (5'–TCCTCCGCTTATTGATATGC–3') were used for amplification and sequencing of the rDNA internal transcribed spacers (White et al. 1990). The nucleotide sequences of the polymerase chain reaction (PCR) products were obtained using direct sequencing in an ABI 3730 xl sequencer (Applied Biosystems, USA). Obtained sequences were analyzed and edited using MEGA7.0 (Kumar et al. 2016) and subsequently, were compared to the sequences available in the NCBI GenBank nucleotide database using the BLASTN search method. Several sequences from GenBank were selected for phylogenetic analyses. Sequence alignment was performed using MUSCLE plug-in of MEGA 7.0 with the default settings (Edgar 2004). Phylogenetic trees were obtained using the minimum-evolution (Rzhetsky & Nei 1992) method in MEGA 7.0 (Kumar et al. 2016). In the minimum-evolution (ME) method, the evolutionary distances were computed using the Kimura 2-parameter method (Kimura 1980). The ME tree was searched using the close-neighbour-interchange (CNI) algorithm at a search level of 1 (Nei & Kumar 2000). The neighbor-joining algorithm was used to generate the initial tree. All ambiguous positions were removed for each sequence pair. The strength of the internal branches from the resulting trees was statistically tested by bootstrap analysis with 1000 replicates (Felsenstein 1985). The ITS sequences determined in this study were deposited in GenBank under the accession numbers MF668614 and MF668615.

RESULTS

In this study, several powdery mildew samples were examined from which two were new for Iran or Guilan province that are described here. Furthermore, some notes are provided for their morphology and ITS sequences.

Erysiphe magnifica (U. Braun) U. Braun & S. Takam., Schlechtendalia 4: 10 (2000) Fig. 1

Magnolia trees heavily infected with a powdery mildew fungus, forming patches or effuse mycelial growth on both sides of leaves. In small leaves, whole leaf was covered with mildew and leaf malformation was also observed. Hyphal cells 2–7 µm wide, hyphal appressoria single or in pairs, nipple-shaped or multilobed. Conidiophores arising from upper surface of mother cell, 45–200 µm long, foot cells cylindrical, straight, but mostly curved, flexuous or distinctly sinuous, 25–75×5–8.5 µm, followed by 1–2 shorter cells being clearly wider than foot cell. Conidia produced singly, ellipsoid, ovoid, doliform to ellipsoid-cylindrical, (27–)33–45(–50) × 14–18 µm, germ tube clearly terminal, usually short, sometimes very long, conidial appressoria simple or mostly multilobed.

Specimen examined. Iran, Mazandaran province, Ramsar, on Magnolia sp., 6 July 2017, S.A. Khodaparast (GUM 775). GenBank: ITS= MF668614.

Erysiphe corylacearum U. Braun & S. Takam., in Braun, Schlechtendalia 8: 33 (2002) Fig. 2

Mycelium on leaves, amphigenous, white, effuse, hyphal appressoria single or in pairs, lobed. Conidiophores arising from upper surface of mother cell, 54–160 µm long, foot cells cylindrical, straight, sometimes slightly sinuous, 40–70 × 7–9.5 µm, followed by 1–2 shorter cells. Conidia produced singly, variable in shape and size, ellipsoid-ovoid, doliiform, (27–)32–42 × 16–22 µm, germ tube terminal, usually short, to long, conidial appressoria simple or lobed.

Specimen examined. Iran, Guilan province, Lahijan, on Corylus avellana, 11 May 2017, S.A. Khodaparast (GUM 786). GenBank: ITS = MF668615.

DISCUSSION

Magnolia powdery mildew in Iran, was found only in the asexual state in this study. This is not uncommon for powdery mildew species in Iran. Hence, some of powdery mildew fungi have only been identified based on the asexual stage and ITS sequences (Khodaparast et al. 2016). Identification of some powdery mildews is usually difficult or impossible without sexual stage.

Four species of Erysiphe sect. Microsphaera viz. E. magnifica (U. Braun) U. Braun & S. Takam., E. magnoliae (Sawada) U. Braun & S. Takam., E. bulbosa (U. Braun) U. Braun & S. Takam. (Braun and Cook 2012) and E. magnoliicola S.E. Cho, S. Takam. & H.D. Shin (Cho et al. 2014) have been recorded on Magnolia s.l.species. These species are well differentiated based on combined anamorphic and teleomorphic characters as well as ITS sequences (Cho et al. 2014). However, identification of E. magnifica and E. magnoliicola based on anamorph characteristic is difficult in practice. Cho et al. (2014) differentiated these two species based on foot cell length. According to their observations, the foot cell of conidiophores was relatively short in E. magnifica [(15–40 µm, up to 50 µm in Korean sample, according to Braun and Cook 2012)] versus long foot cell in E. magnoliicola (42.5–70 µm). However, the Iranian specimen showed foot cells as long as in E. magnoliicola. Nevertheless, the ITS sequence of the Iranian specimen was 100% identical to four ITS sequences of E. magnifica available in GenBank (from Argentina and Germany).

Fig. 1 . Erysiphe magnifica. a. Conidiophores; b–c. Conidia; d. Germinated conidia. Scale bars a=50 µm, b–d=30 µm.

Fig. 2. Erysiphe corylacearum. a. Conidiophores; b–c. Conidia; d. Germinated conidia. Scale bars a =50 µm, b–c = 20 µm, d = 30 µm.

Fig. 3. A minimum-evolution (ME) tree (length = 0.49836697) based on ITS sequences of Erysiphe species. All ambiguous positions were removed for each sequence pair. Bootstrap support values > 50% (1000 replicates) are shown next to the nodes. The sequences generated in this study are shown in bold. Erysiphe australiana is outgroup.

ACKNOWLEDGEMENTS

This work was supported by a grant from the Iran National Science Foundation.