Molecular identification of Tilletia controversa and T. caries, the causal agent of wheat dwarf and common bunt

Document Type: Original Article

Authors

1 Department of Plant Protection, College of Agriculture, Isfahan University of Technology, Isfahan, Iran

2 Department of Plant Protection, College of Agriculture, Yasouj University, Iran

Abstract

Common and dwarf bunt of wheat are recognized as being caused by three closely related species, Tilletia caries and T. laevis as common bunt, and T. controversa as dwarf bunt. The morphological characteristics of two species including T. controversa and T. caries were studied from wheat grown in two provinces of Iran, Lorestan and Chaharmahal–o-Bakhtiari during 2014-2015. In this study, morphological characters could not completely distinguish these pathogens, as in some properties, they showed similarity to T. laevis. So, a collection of twenty wheat bunt isolates was used to compare species in morphological characteristics and phylogenetic relationships. Phylogenetic analyses were presented based on three PCR amplified nuclear DNA fragments including elongation factor 1 alpha (EF1α), the second largest subunit of RNA polymerase II (RPB2) genes and ITS-rDNA region. Maximum likelihood (ML) method was used to determine the phylogenetic relationship among isolates using MEGA v.6 and BEAUti and BEAST v1.6.1 software. Maximum likelihood bootstrap (BS) values and Bayesian posterior probabilities (PP) values were applied as criteria for strongly supported clades. Two species including T. controversa and T. caries were distinguished as different species with DNA sequence information.

Keywords

Main Subjects


INTRODUCTION

Smut fungi belong to the Ustilaginomycetes class and Basidiomycota phylum (Stamatakis et al. 2007). Among smut and bunt fungal diseases causal agents, Tilletia species which are causal agent of bunt and smut of Poaceae family, contain about 140 recognized species (Vánky 1994). Tilletia species produce sori which contain teliospores and sterile cells replaced completely or partially the developing ovary and on the other hand, produce their sori in vegetative organs of grass host. Tilletia caries (DC.) Tul. [=T. tritici (Bjerk.) Wint.], the type species of the genus, causes common bunt of wheat, which is one of the destructive diseases of wheat in human history (Durán & Fischer 1961, Goates 1996).

Two concepts of morphological and phylogenetic analyses have provided sufficient evidence that most species of smut fungi are host genus or species specific (Carris et al. 2007, Bao 2010). Fifty five percent of 600 smut species which are reported from Europe occurred on a single host, 86% on five or fewer hosts and 93% on ten or fewer hosts (Vánky 1994, Begerow et al 2004). Multilocus phylogenetic analysis based on the sequence data from ITS-rDNA, elongation factor 1 alpha (EF1α) and a portion of the second largest subunit of RNA polymerase II (RPB2) supported Tilletia host association between smut species and host genus/species (Carris et al. 2007, Bao 2010). Common bunt caused by T. laevis and T. caries and dwarf bunt caused by T. controversa, play considerable role as the important cereal diseases. In Iran, common bunt is commonly caused by T. laevis as it has been occurred by T. caries in other regions. Morphologically T. caries and T. controversa are morphologically similar and differentiation based on solely spore morphology is quite difficult and somehow impossible, although there are some differences in teliospore gelatinoids sheath thickness and spore reticulate ornamentation, they could be biologically separable. Moreover, genetic structures of these two species are so similar that lots of studies recognized them as a single species and consider T. controversa as a mutant of T caries. Numerous attempts such as application of precise teliospore morphology, fluorescence microscopy, serology and total proteins methods could not differentiate these species and none of them could show trusty differences between two species (Bao 2010). A PCR-RFLP method was developed using RPB2 gene to discriminate Tilletia caries from T. controversa (Zgraja et al. 2016). Monoclonal antibody D-1 against teliospores of T. controversa was also applied (Gao et al. 2014).  In this study, we conducted multilocus phylogenetic analysis based on sequence data from ITS rDNA, elongation factor 1 alpha (EF1α) and a portion of the second largest subunit of RNA polymerase II (RPB2) to examine the hypothesis that multilocus phylogenetic trees can provide evidence to support the morphological species concept of the wheat bunt pathogens.

 

MATERIALS AND METHODS

Sampling and morphological characterization

Symptomatic ears were collected from two provinces of Iran viz., Lorestan and Chaharmahal-o-Bakhtiari during 2014-2015, and taken to the laboratory. Sori were detached from infected wheat ears and placed on a smooth surface and were measured (Bao 2010.). Length and width of 3-5 sori were recorded per specimen where sufficient material was available. Teliospores from bunted florets were soaked in sterile distilled water for 30 min at room temperature and mounted on a microscope slide in Shear’s mounting medium. Spore morphology including teliospore diameter with gelatinous sheath (Durán & Fischer 1961), the thickness of exospore, number of meshes (areolae) per spore diameter and sterile cell diameter were recorded for 20 spores per sample using differential interference contrast microscopy at ×1000. For germination of teliospores, one part of teliospore suspension was plated on 2% water agar with antibiotics and incubated at 16 °C from 10 to 15 days, while the other part of suspension, which was also plated on 2% antibiotic water agar, was incubated at 5 °C in the presence of light from 3 to 6 weeks. These are environmental conditions required for teliospore germination and production of primary sporidia and small colonies with secondary sporidia (Goates 1996). For Autofluorescence, teliospore suspended in water were placed on a microscope slide and allowed to air dry. The spores were then covered with a small amount of nonfluorescing immersion oil and a coverslip (Stockwell & Trione 1986) for visualizing the hyaline sheaths and teliospore were mounted in water and photographed with background lighting.

Genomic DNA extraction                                                        

Total genomic DNA was isolated using a modified CTAB (cetyltrimethyl ammonium bromide) technique. Approximately 100 mg teliospore powder was suspended in 900 μL of extraction buffer (100 mMTris-HCl, 100 mM EDTA, 250 mM NaCl) then 100 μL of 10% N-Lauroylsarcosine (Sigma- Aldrich, Germany) was added. The suspension was incubated at 60° C for 60 min and centrifuged for 10 min at 13000 ×g in a Beckman microfuge (Beckman, USA). Upper phase suspension was transferred to a new microtube. One hundred milliliter of NaCl 5 mM and 200 mL CTAB 5% were added to each tube respectively and the tubes were placed at 65° C for 10 minutes. According to the volume of material contained in each tube, chloroform/isoamyl alcohol (24:1) was added and after mixing, the tubes were centrifuged for 10 minutes at 13000 × g. Upper phase of suspension was transferred to a new 1.5 ml tube and the equal volume of isopropanol was added where the DNA was precipitated at –20° C. To precipitate DNA, tubes were centrifuged for 10 minutes at 13000 ×g then the supernatant was discarded gently. The sediment was washed with about 100 ml of 75% ethanol and once the DNA was precipitated, the pellet was diluted in 100 ml of deionized double-distilled sterile water (Murray & Thompson 1980).

Phylogenetic analysis

Three PCR amplified nuclear DNA fragments including elongation factor 1 alpha (EF1α), the second largest subunit of RNA polymerase II (RPB2) genes and ITS-rDNA region were used in this study (Table 1). PCR amplifications were performed in 20 μL reactions containing 0.05 μM of each primer, 1 × Dream Taq Buffer (MBI Fermentas), 0.4 μM dNTPs (MBI Fermentas) and 0.5 units of Dream Taq DNA polymerase (MBI Fermentas). The PCR cycle parameters were as follow: 2 min initial denaturation at 96°C followed by 35 cycles of 96°C for 30 s, annealing for 45 s, and extension at 72 °C for 1 min. A final extension for 10 min was applied at 72°C. Finally, the quantity and quality of PCR products were evaluated and visualized on 1.5% agarose gel. The gels were stained with ethidium bromide and visually analysed under UV light (GelDoc, Bio-Rad Laboratories). The PCR products were purified with QIA quick columns according to the manufacturer's instructions and amplified products were sequenced in Macrogen, Korea. The consensus regions of EF1α, RPB2 and ITS-rDNA were blasted against the NCBI’s GenBank sequence database using Megablast to identify their closest neighbors. The obtained sequences from GenBank together with the novel generated sequences during this study (table 2), were aligned with MAFFT v.7 online interface using default settings (http://mafft. cbrc.jp/alignment/server/) (Katoh & Standley 2013). Maximum likelihood (ML) methods were used to determine the phylogenetic relationship among isolates using MEGA (Molecular Evolutionary Genetics Analysis) v. 6 software (Tamura et al. 2007) and BEAUti and BEAST v1.6.1 (Drummond & Rambaut 2007). Maximum likelihood bootstrap (BS) values (Reeb et al. 2004) and Bayesian posterior probabilities (PP) values (Drummond & Rambaut 2007) were used as criteria for strongly supported clades. An isolate of Ustilago hordei was used as an outgroup in the combined anonymous loci dataset according to results from multilocus phylogenetic analyses of Tilletia spp.

 

Table 1. Primers characteristics used in this study.

Locus

Sequence (5'-3')

Annealing Temp. (°C)

Reference

RPB2_F

GATGGACGCGGTTTGTAATG

58

Carris et al. 2007

RPB2_R

TCGAAGAGCCAACACTGAGACG

 

 

EF1α –F

TCAACGTCGTCGTCATCGG

55

Carris et al. 2007

EF1α -R

CCGTGCCGATACCACCGATCTT

 

 

ITS –F

GGAAGTAAAAGTCGTAACAAGG

59

White et al. 1990

ITS –R

TCCTCCGCTTATTGATATGC

 

 

 

Table 2. Characteristics of Tilletia species isolates used in phylogenetic analysis.

Host

Location

Host Species

GenBank accession numbers

EF1-α

RPB2

ITS

Tilletia vankyi

Australia

Lolium perenne

EU257587 a

EU257620 a

EU257554 a

T. vankyi

US

Festuca rubra

EU257585a

EU257618a

EU257552a

T. fusca

US

Vulpia microstachys

EU257567 a

EU257601 a

EU257537 a

T. brevifaciens

Poland

Thinopyrum intermedium

EU257565 a

EU257599 a

EU257535 a

T. brevifaciens

Austria

T. intermedium

EU257566 a

EU257600 a

EU257536 a

T. bromi

US

Bromus tectorum

EU257555 a

EU257592 a

EU257528 a

T. bromi

US

B. hordeaceus

EU257557 a

EU257594 a

EU257530 a

T. caries

Australia

Triticum aestivum

EU257559 a

EU257596 a

EU257532 a

T. caries

Sweden

T, aestivum

EU257560 a

EU257597 a

EU257533 a

T. controversa

US

T. aestivum

EU257561 a

EU257598 a

EU257534 a

T. controversa

Germany

T. aestivum

EU257562 a

EU257588 a

EU257526a

T. elymi

US

Elymus glaucus

EU257564 a

EU257591 a

EU257527 a

T. laevis

US

Triticum aestivum

EU257571 a

EU257605 a

EU257541 a

T. laevis

Iran

T. aestivum

EU257573 a

EU257607 a

EU257543 a

T. goloskokovii

US

Apera interrupta

EU257569 a

EU257603 a

EU257539 a

T. goloskokovii

US

Apera interrupta

EU257568 a

EU257602 a

EU257538 a

T. trabutii

Iran

Hordeum murinum

EU257581 a

EU257614 a

EU257548 a

T. trabutii

Australia

H. murinum

EU257582 a

EU257615 a

EU257549 a

T. puccinelliae

US

Puccinellia distans

EU910060 a

EU910066 a

EU910054 a

T. puccinelliae

US

P. distans

EU910061 a

EU910067 a

EU910055 a

T. lolii

Iran

Lolium rigidum

EU257575a

EU257609a

EU257544a

T. lolii

Iran

Loliolum subulatum

EU257576a

EU257610a

EU257545a

T. caries

Iran (Lorestan)

Triticum aestivum

MH781452 b

MH781428 b

MH781414 b

T. caries

Iran (Lorestan)

T. aestivum

MH781449 b

MH781430 b

MH781415 b

T. caries

Iran (Lorestan)

T. aestivum

MH781460 b

MH781429

MH781416 b

T. caries

Iran (Lorestan)

T. aestivum

MH781462 b

MH781431 b

MH781417 b

T. caries

Iran (Lorestan)

T. aestivum

MH781453 b

MH781441 b

MH781418 b

T. caries

Iran (Chaharmahal*)

T. aestivum

MH781450 b

MH781433 b

MH781419 b

T. caries

Iran (Chaharmahal*)

T. aestivum

MH781461 b

MH781438 b

MH781420 b

T. caries

Iran (Chaharmahal*)

T. aestivum

MH781463 b

MH781434 b

MH781421 b

T. caries

Iran (Chaharmahal*)

T. aestivum

MH781454 b

MH781443 b

MH781422 b

T. caries

Iran (Chaharmahal*)

T. aestivum

MH781451 b

MH781442 b

MH781423 b

T. controversa

Iran (Chaharmahal*)

T. aestivum

MH781444 b

MH781424 b

MH781404 b

T. controversa

Iran (Chaharmahal*)

T. aestivum

MH781445 b

MH781425 b

MH781405 b

T. controversa

Iran (Chaharmahal*)

T. aestivum

MH781455 b

MH781426 b

MH781406 b

T. controversa

Iran (Chaharmahal*)

T. aestivum

MH781457 b

MH781427 b

MH781407 b

T. controversa

Iran (Lorestan)

T. aestivum

MH781446 b

MH781432 b

MH781408 b

T. controversa

Iran (Lorestan)

T. aestivum

MH781447 b

MH781440 b

MH781409 b

T. controversa

Iran (Lorestan)

T. aestivum

MH781456 b

MH781435 b

MH781410 b

T. controversa

Iran (Lorestan)

T. aestivum

MH781458 b

MH781436 b

MH781411 b

T. controversa

Iran (Lorestan)

T. aestivum

MH781459 b

MH781439 b

MH781412 b

T. controversa

Iran (Lorestan)

T. aestivum

MH781448 b

MH781437 b

MH781413 b

Ustilago hordei

Germany

Hordeum vulgare

AY740068 a

KF706521 a

JN367380 a

a. Cited from Carris et al. 2007

b. From this study;                                                                                                                          

* Chaharmahal va Bakhtiari were

 

RESULTS

Morphology analysis

The beginning of teliospores germination for collections Tcar1-10 occurred between 2-3 days at 16°C. Whereas, none of the teliospores from collections Tcon1-10 germinated at 16°C over a period of 6 weeks. At 5 °C, teliospores from all the collections germinated, but the onset of germination varied greatly. Teliospore from collections Tcar1-10 germinated within 7-12 days. In contrast, the germination of teliospores from collections Tcon1-10 began between 28-30 days at 25 °C. Based on the germination properties of teliospores, collections Tcon1-10 would have been assigned to T. controversa because they did not germinate at 16 °C and collections Tcar1-10 would have been designated T. caries. Teliospores from collections Tcon1-10 appeared frequently spherical and reticulated and can be visualized reticulations and hyaline sheaths on spores. The teliospores from collections Tcar1-10 were frequently aspherical and slightly reticulated and appeared devoid of sheaths, but had small reticulations. If the presence of reticulations and hyaline sheaths is used for taxonomic characteristic, the teliospores from collections Tcon1-10 are species T. controversa and those from Tcon 1-10 are from either T. caries or T. laevis. Teliospores mounted in immersion oil and viewed by epifluorescence microscopy can be grouped on the basis of autofluorescence as described by Stockwell and Trionc (1986). Teliospores from collections Tcon1-10 had reticulated wall layers and a netlike appearance on the surfaces. These were characteristics that described for teliospores of T. controversa (Stockwell & Trionc 1986). However, teliospores from the Tcar1-10 collections were typically devoid of autofluorescing reticulations, but occasionally nonfluorescent reticulations.

Phylogenetic analysis

The ITS region (800bp), partial nucleotide sequences of the second largest subunit of RNA polymerase II (RPB2) (600 bp) and sequences of elongation factor 1 alpha (EF1α) (800 bp) with a total of 1957 characters, were concatenated and applied for phylogenetic analysis of 40 Tilletia isolates. We used the known pathogenic relatives of Tilletia spp., Ustilago hordei species as outgroups. New Sequences described in this manuscript are deposited in GenBank. A maximum likelihood tree was inferred by combined analysis of all three loci (Fig. 1). Isolates of T. controversa grouped with isolates of T. controversa (Carris et al. 2007) in a well-supported clade (ML-BS: 100%, PP: 98%). Isolates of T. caries grouped with isolates of T. caries (ML-BS: 100%, PP: 97%) (Carris et al. 2007). Other well-supported clades include those containing isolates of T. vankyi (ML-BS: 99%, PP: 94%), T. brevifaciens (ML-BS: 100%, PP: 99%),T. goloskokovii (ML-BS: 99%, PP: 100%),T. puccinellia (ML-BS: 96%, PP: 95%), T. trabutii (ML-BS: 97%, PP: 96%), T. fusca (ML-BS: 100%, PP: 99%), T. elymi (ML-BS: 100%, PP: 100%), T. bromi (ML-BS: 97%, PP: 100%), T. laevis (ML-BS: 98%, PP: 100%) and T. lolii (ML-BS: 97%, PP: 97%).

DISCUSSION

Two teliospore collections obtained from bunted wheat grown in two provinces of Iran viz., Lorestan and Chaharmahal va Bakhtiari were examined for the following characteristics currently used in differentiating T. caries from T. controversa, including presence or absence of a prominent hyaline sheath (Duran & Fischer 1961), the temperature at which the teliospores germinated (Hoffmann 1982) and the autofluorescence properties of the teliospores (Stockwell&Trione 1986). Our results showed that in some cases, these traits could not successfully distinguish T.controversa from T. caries and sometimes failed to distinguish both species from T. laevis. Criteria used in separation of T. caries from T. controversa is one of degree only (Holton & Kenddrick 1956), although these characters such as host stunting could be considered as identifier of dwarf bunt, but some races of T. caries or T. laevis could do it on certain varieties of wheat (Holton & Rodenhiser 1942). Teliospore germination requirements are more difficult to ascertain, requiring six weeks or longer for T. controversa, and cannot be determined for old or otherwise nonviable collections. Moreover, the range of germination conditions between common bunt and dwarf bunt were shown to be overlapped (Russell & Mills 1994). For example, light is not necessary for the germination of some isolates of dwarf bunt (Meiners&Waldher 1959). Teliospore size and sorus shape have not been emphasized as characters in wheat bunt identification in previous studies. Kühn (1874) observed that spores of T. controversa were on average 1 μm smaller than those of T. caries and Fischer (1952) noted the sori of T. brevifaciens were “hard and compact” in comparison to those of T. caries. Teliospore ornamentation and thickness of gelatinous sheaths were also highly variable between isolates and among teliospores within isolates (Holton & Kendrick 1956). Moreover, Hoffmann (1982) acknowledged that extreme variation in the depth of the reticulations and the presence or absence of a prominent hyaline sheath are also characteristics of the teliospores of other species that infect grasses, which makes it difficult, if not impossible, to use these morphologic criteria for species identification.

Russell & Mills (1994) suggested that the genes conferred different teliospore morphologies and germination phenotypes are likely to be alternate alleles that can arise through mutation and recombination in natural populations. Although dwarf and common bunt are acknowledged to be epidemiologically distinct diseases, the etiologic agents appear to be essentially indistinct. Genetic and biochemical analyses provide strong evidence that T. caries, T. controversa, and T. laevis are variant forms of one species, which occur because of genetic variation present in natural populations. The classification schemes presently used to differentiate T. caries and T. controversa rely on phenotypes that are common to both pathogens. Although some previous studies have provided evidence supporting the recognition of three morphological species of wheat bunt pathogens, their conclusions must be assessed in the context of number and diversity of the isolates that were analyzed (Stockwell & Trione 1986, Liu et al. 2009). Moreover, an anonymous molecular marker was developed to distinguish T. controversa from common bunt species and tested on 15 common bunt isolates and T. controversa races D1-D17 isolates (Liu et al 2009). Number of isolates and the selection of the loci are two common problems in molecular phylogenetic studies that may produce bias in the results (Leigh et al. 2003).

Utilization of monoclonal antibody D-1 revealed that the orange cycle fluorescent signal was stronger in T. controversa teliospores, whereas only the green signal was observed in of T. caries teliospores (Gao et al 2014). In addition, a PCR-RFLP method which was developed for species discrimination using HinfI in RPB2 gene showed that T. controversa produced two fragments, whereas T. caries was digested into three fragments (Zgraja et al 2016),  but still with no clear distinguishing species. In the present study, ML consensus tree was supported by Bayesian inference and bootstrap values. We could separate the morphological species for the common and dwarf bunt pathogens of wheat using multi-gene phylogenies. The lack of correlation between phylogenetic species and morphological species is supported by previous studies examining the relationship among the wheat bunt pathogens and related species. Russell and Mills (1994) compared wheat bunt isolates from Oregon, Pakistan and Turkey and observed that two Pakistan collections were intermediate between a common bunt and dwarf bunt in taxonomic criteria used for species determination. Shi et al (1996) used RAPD loci to analyze the genetic relationships among 66 isolates of wheat bunt fungi and their results showed that most of the dwarf bunt isolates fell into one group and a mixture of dwarf and common bunt isolates in the second group; however neither group was supported by bootstrap analysis. Shi et al (1996) also found two distinct restriction digest patterns in 5.8s and ITS rDNA among wheat bunt isolates. One haplotype was associated with 85% of the dwarf bunt isolates and the second haplotype was associated with all of the common bunt and four dwarf bunt isolates.

 

Fig 1. Maximum likelihood tree of T. controversa and T. caries isolates and related species with the combination of EF1A, ITS1 and RPB2 genes. Branch length indicates the substitution rate. Maximum likelihood bootstrap (BS) values are indicated on branches, and Bayesian posterior probabilities (PP) values are indicated under branches.

 

ACKNOWLEDGMENTS

This work was supported by the Isfahan University of Technology and the authors also wish to thank Dr. P. Rahimi for her contribution during the analysis of data. The authors would like to thank the anonymous reviewers and editor for their valuable comments and suggestions to improve the quality of the manuscript.

Andrew M, Peever TL, Pryor BM. 2009. An expanded multilocus phylogeny does not resolve morphological species within the small-spored Alternaria species complex. Mycologia 101:95-109.

Bao X. 2010. Host specificity and phylogenetic relationships among Tilletia species infecting wheat and other cool season grasses. Washington State University.

Begerow D, Göker M, Lutz M, Stoll M. 2004. On the evolution of smut fungi on their hosts. In:Frontiers in Basidiomycete Mycology. (R Agerer, M Piepenbring, & MBlanz, eds): 81-98. IHW‐Verlag, Germany.

Carris LM, Castlebury LA, Huang G, Alderman SC, Luo J, Bao X. 2007. Tilletia vankyi, a new species of reticulate-spored bunt fungus with non-conjugating basidiospores infecting species of Festuca and Lolium. Mycological Research 111:1386-1398.

Castlebury LA, Carris LM, Vánky K. 2005. Phylogenetic analysis of Tilletia and allied genera in order Tilletiales (Ustilaginomycetes; Exobasidiomycetidae) based on large subunit nuclear rDNA sequences. Mycologia 97:888-900.

Dettman J, Jacobson D, Taylor J. 2003. A multilocus genealogical approach to phylogenetic species recognition in the model eukaryote Neurospora. Evolution 57:2703-2720.

Drummond AJ, Rambaut A. 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology7, 214.

Durán R, Fischer GW. 1961. The genus Tilletia. Washington State University.

Fischer GW. 1952. Tilletia brevifaciens sp. nov., causing dwarf bunt of wheat and certain grasses. Research Studies of the State College of Washington 20:11-14.

Gac ML, Hood ME, Fournier E, Giraud T. 2007. Phylogenetic evidence of host-specific cryptic species in the anther smut fungus. Evolution 61:15-26.

Gao L, Feng C, Li B, Liu T, Liu B, Chen W. 2014. Detection of Tilletia controversa using immunofluorescent monoclonal antibodies. Journal of Applied Microbiology 118:497-507.

Giraud T, Refregier G, Le Gac M, de Vienne DM, Hood ME. 2008. Speciation in fungi. Fungal Genetics and Biology 45:791-802.

Goates BJ. 1996. Common bunt and dwarf bunt. In: Bunt and Smut Diseases of Wheat: Concepts and Methods of Disease Management. (RD Wilcoxson &EE Saari, eds):12-25.CIMMYT, Mexico D.F.

Hoffmann JA. 1982. Bunt of wheat. Plant Disease 66:979-986.

Holton CS, Kendrick EL. 1956. Problems in the delimitation of species of Tilletia occurring on wheat. Research Studies of the State College of Washington 24:318-325.

Harrington TC, Rizzo DM. 1999. Defining species in the fungi. In: Structure and dynamics of fungal population. (JJ Worrall, ed.): 43-70. Kluwer Press, Dordrecht, the Netherlands.

Kühn J. 1874. Tilletia contraversa. Hedwigia 13:188-189. Rabenhorst, L. Fungi europaeiexs. 1801-1900. Dresden

Leigh J, Seif E, Rodriguez N, Jacob Y, Lang B. 2004. Fungal evolution meets fungal genomics. In: Handbook of fungal biotechnology. (DK Arora, PD Bridge & D Bhatnagar, eds.): 145-162. Marcel Dekker, New York.

Liu JH, Gao L, Liu TG, Chen WQ. 2009. Development of a sequence-characterized amplified region marker for diagnosis of dwarf bunt of wheat and detection of Tilletia controversa Kühn. Letters in Applied Microbiology 49:235-240.

Meiners JP, Waldher JT. 1959. Factors affecting spore germination of twelve species of Tilletia from cereals and grasses. Phytopathology 49:724-728.

Murray MG, Thompson WF. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research 8: 4321-4326.

O'Donnell K. 2000. Molecular phylogeny of the Nectria haematococca-Fusarium solani species complex. Mycologia 92:919-938.

Piepenbring M. 2003. Smut Fungi (Ustilaginomycetes P.P. and Microbotryales, Basidiomycota). Flora Neotropica 86:1-291.

Reeb V, Lutzoni F, Roux C. 2004. Contribution of RPB2 to multilocus phylogenetic studies of the Pezizomycotina (euascomycetes, Fungi) with special emphasis on the lichen-forming Acarosporaceae and the evolution of polyspory. Molecular Phylogenetics and Evolution 32: 1036–1060.

Russell BW, Mills D. 1994. Morphological, physiological, and genetic evidence in support of conspecific status for Tilletia caries, T. controversa, and T. foetida. Phytopathology 84:576-582.

Stamatakis A, Auch AF, Meier-Kolthoff J, Göker M. 2007. AxPcoords& parallel AxParafit: statistical co-phylogenetic analyses on thousands of taxa. BMC Bioinformatics 8:405.

Shi YL, Loomis P, Christian D, Carris LM, Leung H. 1996. Analysis of the genetic relationships among the wheat bunt fungi using RAPD and ribosomal DNA markers. Phytopathology 86:311-318.

Stockwell V, Trione EJ.1986. Distinguishing teliospores of Tilletia controversa from those of T. caries by fluorescence microscopy.  Plant Disease70:924-926. 

Tamura K, Dudley J, Nei M, Kumar S. 2007. Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0.Molecular Biology and Evolution 24: 1596–1599.

Vánky K. 1994. European smut fungi. Gustav Fischer Verlag, Stuttgart, Jena, New York.

Zgraja G, Kramer S, Jonitz A, Wagner, W. 2016. Identification and quantification of Tilletia caries and T. controversa in seed samples and discrimination of the two species. Journal of Botanical Sciences 5: 5-11.