Gene deletion patterns in non-aflatoxigenic isolates of Aspergillus flavus

Document Type: Original Article

Authors

1 Department of Plant Protection, Faculty of Agriculture, Ferdowsi University of Mashhad, Iran.

2 Department of Agricultural Biotechnology, Faculty of Agriculture, Ferdowsi University of Mashhad, Iran

3 Department of Plant Protection, Faculty of Agriculture, Ferdowsi University of Mashhad, Iran

4 Southern Regional Research Center, Agricultural Research Service, U.S. Department of Agriculture, 1100 Robert E. Lee Boulevard, New Orleans, Louisiana 70124, USA

Abstract

Fifteen non-aflatoxigenic strains of Aspergillus flavus, represent a wide range of geographic regions of Iran (six provinces include Fars, Ardebil, Guilan, Golestan, Kerman and Semnan) and vegetative compatibility groups (VCGs), were collected from corn (Zea mays L.), peanut (Arachis hypogaea L.) and pistachio (Pistachia vera L.) soils and kernels, were screened for the presence of aflatoxin biosynthesis genes in relation to their capability to produce aflatoxins, targeting the regulatory genes afIR and aflJ, the structural genes aflT, pksA, ver-1, omtA, omtB, aflD, ordA, verA, norA, hypA, norB, cypA, sugar utilization gene glcA and flanking region gene C3 (5' end) by PCR method. The result was the grouping of A. flavus strains into twelve different amplification patterns (I-XII), characterized by 10-14 different DNA bands. Our results revealed that, aflatoxin biosynthesis regulatory genes (aflR and aflJ) and the structural gene hypA are more important genes to detect non-aflatoxigenic strains of A. flavus. For non-aflatoxigenic strains of A. flavus, no relationship was observed between the deletion pattern and geographic origin/or VCG; this may indicate that our non-aflatoxigenic strains of A. flavus did not originate independently at each locality. It is concluded that the aflatoxin gene cluster variability existing in then non-aflatoxigenic populations of A. flavus can be useful for understanding the toxicological risk as well as the selection of biocontrol agents.

Keywords

Main Subjects


INTRODUCTION

 

Aflatoxins (AFs) are highly toxic and carcinogenic in animals and humans, leading to hepatotoxicity, teratogenicity, immunotoxicity and even death (Motomura et al. 1999, Wen et al. 2005). Contamination of corn (Zea mays L.), peanuts (Arachis hypogaea L.) and pistachio (Pistachia vera L.) by aflatoxins is a severe economic burden for Iranian growers (Cheraghali et al. 2007, Hedayati et al. 2010, Ghiasian et al. 2011).

Aspergillus section Flavi includes three economically important species: A. flavusA. parasiticusand A. nomius. Even though these species share numerous common features, they differ in a major attribute, their ability to produce AFs. This widely distributed group of aflatoxigenic species is considered a major problem for animal and human health, since those species are able to grow in almost any kind of crop or food.

After the discovery of a gene cluster as the regulator of AF biosynthesis (Brown et al. 1996), the biosynthetic pathway of AFs has been extensively studied, and most of the enzymes and corresponding involved genes have been identified (Ehrlich et al. 2005, Yabe & Nakajima 2004, Yu et al. 2005, Keller et al. 2005, Wen et al. 2005, Cary & Ehrlich 2006). AF biosynthesis requires at least 25 enzymes and two regulatory proteins encoded by contiguous genes in an 80-kb cluster (Scherm et al. 2005, Yu et al. 2005, Bhatnagar et al. 2006).

The functions of most of the genes required for aflatoxin production have been identified by genetic complementation (Motomura et al. 1999, Chang et al. 2000, Yu et al. 2000).

Generally, the AF biosynthesis genes of A. flavusA. parasiticus and A. nomius are highly homologous, since the order of the genes within the cluster are the same (Ehrlich et al. 2005, Chang et al. 2007). A significant proportion, but not all of the non-aflatoxigenic A. flavus isolates have been found to contain various deletions in the AF gene cluster (Ehrlich & Cotty 2004, Chang et al. 2005, 2006) which are also common in some strains of A. oryzae (Chang et al. 2005, 2006). The loss of the ability to produce AFGs in A. flavus seems to result from a deletion in the terminal region of the cluster corresponding to genes aflF (= norB) and aflU (= cypA) (Ehrlich et al. 2004).

Molecular techniques have been widely applied to distinguish the aflatoxin producing and non-producing strains of A. flavus and related species, through the correlation of presence/absence of one or several genes involved in the AF biosynthetic pathway and the ability/inability to produce AFs. Recently, DNA–based detection systems have been introduced as powerful tools for detecting and identifying the aflatoxin producing fungi (Geisen 1996). The polymerase chain reaction (PCR) is the method of choice for this purpose (Shapira et al. 1996).

Färber et al. (1997) detected the aflatoxigenic strains of A. flavus in contaminated figs by performing a monomeric PCR with three sets of primers specific for three structural genes of the AF biosynthetic pathway, aflDaflM and aflO. Other attempts to develop PCR-based methods for detection of aflatoxigenic fungi (A. flavus and A. parasiticus) were underway (Chen et al. 2002, Mayer et al. 2003, Scherm et al. 2005, Baird et al. 2006, Lee et al. 2006, Rahimi et al. 2008). PCR-based methods utilize primers for aflatoxin genes not necessarily unique to aflatoxigenic fungi. These methods have not been tested for reproducibility on a number of different contaminated commodities (Bhatnagar et al. 2006).

Reports on deletion patterns of non-aflatoxigenic A. flavus strains are different. For instance, the loss of aflatoxin production in strain A. flavus 649-1 is associated with large deletions in the aflatoxin gene cluster (Prieto et al. 1996). Non-aflatoxigenic A. flavus AF36, widely used in the management of aflatoxin contamination of cotton in Arizona, has a defect in the gene pksA (Ehrlich & Cotty 2004). Rodrigues et al. (2009) reported that gene expression of aflD in Aspergillus section Flavi was a good indicator to distinguish between toxigenic and non-toxigenic strains of A. flavus. Okoth et al. (2012) tested A. flavus and A. parasiticus isolates for the presence of aflD and aflQ genes.

Strains of Aflavus show a great variation in their ability to produce aflatoxins. There are a number of Aspergillus species that produce aflatoxin but are not classified as section Flavi (Cary & Ehrlich 2006). Greatest successes to date in biological control of aflatoxin contamination in both pre- and post-harvest crops have been achieved through application of biocompetitive non-aflatoxigenic strains of Aflavus and/or Aparasiticus (Yin et al. 2008).

In the current study, we identified genomic deletions of non-aflatoxigenic strains of A. flavus based on polymerase chain reaction with the aflatoxin biosynthesis gene cluster analysis.

 

MATERIALS AND METHODS

 

Fungal strains

Fifteen non-aflatoxigenic strains of A. flavus from a collection of 52 strains from peanut (IRG075, IRG129 and IRG517), corn (IRM074, IRM193, IRM014, IRM211, IRM031, IRM041 and IRM081) and pistachio (IRP049, IRP107, IRP082, IRP144), representing a wide range of geographic regions of Iran and different vegetative compatibility groups (IR1 to IR15; unpublished data) were used for this study (Tables 1 & 2). Morphological characterization of non-aflatoxigenic strains of A. flavus was based on seriation on Czapek Yeast Agar (CYA)25. The observed characteristics on this medium were as follows: conidia ornamentation, conidia size (μm), colony color and sclerotia. The colony diameter (cm) was measured on CZ42. Conidia of A. flavus species have relatively thin and finely to relatively rough walls. Their shapes vary from spherical to elliptical, and when grown on Czapek-Dox (CZ), colonies of A. flavus are yellowish-green (Klich, 2002, Samson et al. 2004, 2006, Pildain et al. 2008) (Table 1).

 

Table 1. List of non-aflatoxigenic strains of Aspergillus flavus.

Strain

Sclerotia

on CYA25a

Seriation

on CYA25b

Conidia

on CYA25

Diameter

on CZ42c

Colony color

on CYA25

AFBs

on YES

IRP-049

> 400

b/u

Smooth

1.8

yellowish-green

-

IRP-107

> 400

B

Smooth

1.7

yellowish-green

-

IRP-082

-

B

Smooth

2.5

yellowish-green

-

IRP-144

> 400

B

Smooth

2

yellowish-green

-

IRG-075

> 400

b/u

Smooth

1.5

yellowish-green

-

IRG-129

-

B

Smooth

2.9

yellowish-green

-

IRM-074

> 400

b/u

Smooth

3

yellowish-green

-

IRM-193

-

B

Smooth

2

yellowish-green

-

IRM-014

> 400

n.d.

n.d.

2.8.

yellowish-green

-

IRM-211

> 400

u/b

Smooth

2.6

yellowish-green

-

IRP-179

> 400

B

Smooth

2.7

yellowish-green

-

IRG-517

-

n.d.

n.d.

1.8

yellowish-green

-

IRM-031

> 400

B

slightly rough

2.3

yellowish-green

-

IRM-041

> 400

B

smooth

2.9

yellowish-green

-

IRM-081

-

B

smooth

2.7

yellowish-green

-

-: not detected   n.d.: not determined   a: size, in μm: average of 15 sclerotia    b: u = uniseriate; b = biseriate; u/b = predominantly uniseriate; b/u = predominantly biseriate     c: average of 3 colonies, in cm.

 

Table 2. Non-aflatoxigenic strains of Aspergillus flavus used in this study.

Strain isolate

VCGs

Geographical origin

Source

Sclerotium production

IRP-049

IR1

Rafsanjan

pistachio soil

+/L

IRP-107

IR2

Rafsanjan

pistachio soil

+/L

IRP-082

IR3

Damghan

pistachio soil

-

IRP-144

IR4

Damghan

pistachio soil

+/L

IRG-075

IR5

Minoodasht

Peanut soil

+/L

IRG-129

IR6

Astaneh-e Ashrafieh

Peanut soil

-

IRM-074

IR7

Darab

Maize soil

+/L

IRM-193

IR8

Fasa

Maize soil

-

IRM-014

IR9

Parsabad

Maize soil

+/L

IRM-211

IR10

Parsabad

Maize soil

+/L

IRP-179

IR11

Rafsanjan

pistachio kernel

+/L

IRG-517

IR12

Astaneh-e Ashrafieh

Peanut kernel

-

IRM-031

IR13

Parsabad

Maize soil

+/L

IRM-041

IR14

Darab

Maize kernel

+/L

IRM-081

IR15

Darab

Maize kernel

-

+: Sclerotia producer               -: Sclerotia non-producer               L: Sclerotia >400 µm on CYA25

 

Aflatoxin analysis

All of the isolates were initially screened for aflatoxigenic ability on yeast extract sucrose agar medium (YES: Yeast Extract 20 g/L, Saccharose 150 g/L, Agar 15 g/L) amended with 0.3% (w/v) methylated β-cyclodextrin (mß-CD) (Fente et al. 2001). All of the non-aflatoxigenic strains of A. flavus were re-tested for confirmation of AFs production in AF-inducing YES. Strains were inoculated on Petri dishes containing YES and incubated at 25-27 °C for 7 days in the dark. A Method based on HPLC with fluorescence detection has been suggested to measure aflatoxins B in A. flavus isolates (Bragulat et al. 2001). Briefly, extraction of aflatoxin using MeOH/H2O (80:20, v/v) and purification by an immunoaffinity column cleanup were carried out. HPLC system was equipped with an autosampler; a pump (Sykam 2100) and a reverse phase C18 column (Genesis ODS2, 250×4.6 mm, 5 μm), fitted with a precolumn with the same stationary phase and a fluorescence detector (RF-10AXL).

The injection volume was 100 µL. The fluorescence detection was carried out at excitation and emission wavelengths of 365 nm and 435 nm, respectively (detection limit = 0.5 ng/g). A standard solution of AFB1 and AFB2 (Sigma Co.) was used. HPLC grade solvents (methanol and acetonitrile) were used to prepare the AF standards in the sample extraction, and also to prepare the mobile phase. The A. flavus aflatoxin producing strain SRKC-G1907 which released only aflatoxins of group B was used as the reference strain.

 

Isolation of genomic DNA

Total DNA was extracted from mycelia of fungal isolates obtained from 7-day-old cultures grown in YES liquid media according to Prabha et al. (2013) with minor modifications.

The DNA concentration was measured with a UV-Vis spectrophotometer (NanoDrop ND-1000, Wilmington, Delaware USA).

 

Molecular detection of A. flavus isolates

All the non-aflatoxigenic strains of A. flavus were detected based on sequence analysis of ITS2 rDNA by using specific primer pair FVAVIQ1:5'-GTC-GTC-CCC-TCT-CCG-G-3´ and FLAQ2: 5´-CTG-GAA-AAA-GAT-TGA-TTT-GCG-3', as described by Sardiñas et al. (2011). The primer pairs were based on three multicopy ITS2 rDNA target sequences. The primers FLAVIQ1/FLAQ2 yielded an amplicon of 100 bp in A. flavus.

 

Analysis of aflatoxin biosynthesis gene cluster PCR primers

To design oligonucleotide primers, known sequences for aflT, pksA, afIR, aflJver-1, omtA, omtB, aflD, ordA, verA, norA, hypA,norB-cypA intergenic region (norB and cypA genes), glcA(sugar utilization gene) and C3 (flanking region gene, 5'end) were derived from the aflatoxin biosynthetic pathway genes of A. flavus AF36 (AY 510455), AF70 (AY 510453), AF13 (AY510451), BN008 (AY 510451.1) and A. parasiticus AY371490 were obtained from GenBank (http://www.ncbi.nlm.nih.gov/). Primer pairs designed using OLIGO (version 5.0; National Biosciences) are depicted in Table 3. Some primer sets were based on Chang et al. (2005) and Ehrlich et al. (2005). The housekeeping gene tub1 coding for ß-tubulin (primer pair tub1-F/tub1-R) was chosen as a system control for PCR (internal amplification control). The PCR products were analyzed by electrophoresis in 1.5% agarose gels, which were stained with DNA green viewer dye (green fluorescent stain, 10 mg/ml).

 

PCR analysis

The fifteen non-aflatoxigenic strains of A. flavus were tested for presence of 14 genes and one intergenic region of aflatoxin biosynthesis gene cluster by PCR amplification in a 25 µl reaction mixture in a Biometra Thermal Cycler (T1 thermocycler; Biometra, Göttingen, Germany).

 

Table 3. Primers used in this study, target gene, sequence and expected PCR product size.

Primers

Gene(s)

Primer sequence (5'        3')

PCR product Size (bp)

Reference

aflT-F

aflT

Tgcggacatctaacgaccat

750

Chang et al.(2005)

aflT-R

 

Aggtcacttcgttcgtgaagg

 

 

pksA-II-F

pksA

Cagttgctcccaaggagtggt

518

This study

pksA-II-R

 

Gctgggrttctgcatgggtt

 

 

aflR-II-F

aflR

Aaccgcatccacaatctcat

794

This study

aflR-II-R

 

Gcagttcrctcagaacragctg

 

 

aflJ-II-F

aflJ

Cttcaacaacgaccmaaggtt

788

This study

aflJ-II-R

 

Tcggttgtcatcgttatcca

 

 

aflM-II-F

ver-1

agccaaagtcgtggtkaact

786

This study

aflM-II-R

 

Ccatccaccmcaatgatct

 

 

aflP-II-F

omtA

ctcctcwaccagyggcttcg

593

This study

aflP-II-R

 

caggatatcattgtggaygg

 

 

aflO-III-F

omtB

acttggcattcygaataggc

643

This study

aflO-III-R

 

aacccasaataggtcgcatc

 

 

aflD-II-F

nor1

accgctacgccggcrctctcggcac

400

This study

aflD-II-R

 

gttggccgccagcttcgacactccg

 

 

aflQ-II-F

ordA

ttaaggcagcggaatacaag

719

This study

aflQ-II-R

 

gacgsccaaagccraacacaaa

 

 

aflN-II-F

verA

ccgcaacaccacmaagtagca

424

This study

aflN-II-R

 

aaacgctctccaggcmcctt

 

 

aflE-F

norA

gtgttcgtgtgtcgccctta

770

Chang et al. (2005)

aflE-R

 

gtcggtgcttctcatcctga

 

 

aflY-F

hypA

gcatgtccgtcgtcctgata

654

Ehrlich et al. (2005).

aflY-R

 

cccattgatcaatctcggat

 

 

C3-F

C3

tctggagtcggaggttaggtt

544

Chang et al. (2005)

C3-R

 

gagcaacacgatcattgcat

 

 

glcA-F

glcA

aagacacagtcatcgcctgtt

745

Chang et al.(2005)

glcA-R

 

acgcctttatcgagccaata

 

 

norB-cypA-F

norB, cypA

gtgcccagcatcttggtcca

300,800,1800

Ehrlich et al.( 2004)

norB-cypA-F

 

aggacttgatgattcctcgtc

 

 

Tub1-F

tub1

gtccggtgctggtaacaact

902

Chang et al.(2005)

Tub1-R

 

ggaggtggagtttccaatga

 

 

 

DNA amplification conditions

Fourteen aflatoxin clustered genes and the intergenic region norb-cypA were amplified using the primers at a concentration of 10 pmol/μl, 50 ng template DNA, 50 μmol of each of the four dNTPs and 5 units of Taq polymerase (BioNeer Inc., Korea) in a total volume of 25 μl containing 10× assay buffer (1× contains 10 mmol/l Tris-HCl, pH 8.8 at 25°C, 50 mmol/l KCl, 1.5 mmol/l MgCl2). PCR conditions were as follows: denaturation at 95°C for 2 min; 30 cycles of 94°C for 60 sec, primer-specific annealing temperature at 45°C for 60 sec, extension at 72°C for 90 sec and a final extension at 72°C for 5 min. The reaction was carried out in the Biometra Thermal Cycler.

 

Gel electrophoresis

The PCR products were resolved by electrophoresis in a 1.5% agarose gel in 0.5X TBE buffer. The amplified products were visualized under UV transilluminator (UVsolo TS gel documentation system, Biometra Co.) and compared with a standard DNA size marker (Thermo Fisher Scientific Inc., Fermentas, Germany).

 

RESULTS

 

Aflatoxin analysis

In our study, absence of fluorescence on mß-CD was correlated with no AFs production (determined by HPLC). This medium did not yield any false-negatives. In the other words, all the A. flavus strains had already been characterized for their aflatoxigenic ability, after mycelium collection YES broth were analyzed by reverse-phase HPLC to confirm the AF production. Since AF production is extremely dependent on growth conditions, it was important to determine aflatoxigenic ability under the current test conditions.

 

Molecular detection of A. flavus isolates

All the fifteen non-aflatoxigenic strains of A. flavus had the species specific gene, and were therefore confirmed as A. flavus (Fig 1).

 

Deletions in the aflatoxin gene cluster

Oligonucleotide primer sets (Table 3) targeted PCR products of 0.3–1.8 kb (300-1800 bp). In the present study, additional set of primers specific for the aflRpksAaflJver1omtAomtB and aflD genes were also used. The PCR results are summarized in Table 4. On the basis of PCR assay, we grouped the fifteen non-aflatoxigenic strains of A. flavus into deletion patterns. The genomic deletions were identified in all the fifteen A. flavus strains examined, resulting in loss of parts of genes from the aflatoxin gene cluster (Table 2). Based on the banding patterns, twelve deletion patterns (I-XII), designated as A to L were detected among the non-aflatoxigenic strains of A. flavus. The deletion patterns of examined non-aflatoxigenic strains of A. flavus are shown in Table 5. The non-aflatoxigenic strains of A. flavus were placed into five groups based on their number of amplified genes (Table 6). Two strains IRP049 and IRP082 from pistachio have identical deletion patterns (C and I, respectively, Table 6). Deletion patterns were mainly in the left side of aflatoxin gene cluster (hypA, about 10-15 kb) and regulatory genes aflR and aflJ (approximately 35 kb).

Three independent deletions as type I, type II and type III were found in the norB-cypA region (Table 4). Only in A. flavus strain IRG75 from peanut the norB and cypA (norB-cypA intergenic region, deletion pattern type III) were not amplified. In addition, in twelve strains of A. flavus from pistachio and maize and two peanut strains (IRG129, IRG517), the fragments 0.8 and 0.3 kbp were amplified by primer pair norB-cypA-F/norB–cypA-R. Individual VCGs contain isolates from different deletion patterns (Table 6).

 

DISCUSSION

In this study, 15 of the 52 non-aflatoxigenic strains of A. flavus collected from soil and kernel of peanut, maize and pistachio belonging to various geographical regions and distinct VCGs were analyzed for aflatoxin gene cluster deletion patterns. The 15 non-aflatoxigenic strains of A. flavus were selected in this study, because they had proved to produce polymorphic DNA fragments based on microsatellite primed-PCR (MP-PCR) marker and different VCGs in previous studies (Houshyarfard et al. 2014).

 

                                                            M    1     2    3     4    5    6    7    8     9   10   11  12  13  14  15  M  C+

 

 

Fig.1. Specific amplification of internal transcribed spacer regions 1 and 2 (ITS1 and ITS2) of extracted genomic DNA electrophoresed in 1.5% (w/v) agarose gel from fifteen aflatoxin non-producing strains of Aspergillus flavus. C= positive control, M = Molecular marker (50 bp DNA Ladder, Fermentas).

  

Table 4. Prevalence of aflatoxin-associated genes among fifteen Iranian non-aflatoxigenic strains of A. flavus.

 

 

 

 

 

 

 

 

 

Genes**

 

 

 

 

 

 

 

Strain

Source*

aflT

pksA

aflR

aflJ

ver1

omtA

omtB

aflD

ordA

verA

norA

hypA

C3

glcA

norB-cypA

IRP-049

S/P

+

-

+

+

+

+

+

+

+

+

+

+

+

+

II

IRP-107

S/P

-

+

-

+

+

+

+

+

+

+

+

+

+

+

II

IRP-082

S/P

+

+

-

-

+

+

-

+

+

-

+

-

+

+

II

IRP-144

S/P

-

+

-

-

+

+

+

+

+

+

+

-

+

+

II

IRG-075

S/G

+

+

-

+

+

+

+

+

+

+

+

-

+

+

III

IRG-129

S/G

+

+

-

-

+

+

+

+

+

+

+

-

+

+

I

IRM-074

S/M

+

+

-

+

+

+

+

+

+

+

+

-

+

+

II

IRM-193

S/M

+

+

-

+

+

+

+

+

+

+

+

-

+

+

II

IRM-014

S/M

+

+

-

+

+

+

+

+

+

+

+

-

+

+

II

IRM-211

S/M

+

+

-

-

+

+

+

+

+

+

+

-

+

+

II

IRP-179

K/P

+

-

-

+

+

+

+

+

+

+

-

-

+

+

II

IRG-517

K/G

+

+

+

+

+

+

+

+

+

+

+

-

-

+

I

IRM-031

S/M

+

+

-

-

+

+

+

+

+

-

+

-

-

+

II

IRM-041

K/M

+

+

-

+

+

+

+

+

+

+

-

-

+

+

II

IRM-081

K/M

+

+

-

-

+

+

+

+

+

+

+

-

+

+

II

SRKC-G1907

Control

+

+

+

+

+

+

+

+

+

+

+

+

+

+

+

*: S : Soil     K: Kernel    P: Pistachio    G: Peanut     M: Maize     +: present     -: absent     Isolate name in bold indicates the aflatoxin producer.

 

Table 5. Deletion patterns (A-L) in the aflatoxin gene cluster of non-aflatoxigenic strains of A. flavus.

Deletion pattern

 

C3

norB-cypA

aflT

pksA

aflD

(nor1)

aflR

aflJ

(afls)

aflE

(norA)

aflM

(ver-1)

aflN

(verA)

aflO

(omtB)

aflP

(omtA)

aflQ

(ordA)

aflY

(hypA)

glcA

A

I

B

I

C

II

D

II

E

II

F

II

G

II

H

II

I

II

J

II

K

II

L

III

Filled and empty circles indicate positive and negative PCR products in Iranian strains, respectively. Original gene names are above and new names are below (Yu et al. 2004). Types I, II and III deletions in the norB-cypA region indicate 0.3 kb, 0.8 kb and no product, respectively. C3 and glcA genes are in the flanking and sugar utilization regions of the aflatoxin gene cluster.

 

Table 6. Grouping of aflatoxin non-producing strains of A. flavus based on the number of amplified genes and one intergenic region.

Group

No. of amplicons

Strains

Deletion pattern

1

14

IRP049

C

2

13

IRP107, IRM193, IRM074, IRM014, IRG517

A,D,E

3

12

IRM041,IRM081,IRM211,IRG129,IRG075

B,F,G,L

4

11

IRP179,IRP144

H,K

5

10

IRM031, IRP082

I,J

 

It is to be emphasized that the PCR detection of A. flavus is no guarantee of aflatoxin production, since genes other than those involved in the biosynthesis of aflatoxins are not targeted for amplification. Bearing in mind that our molecular studies were applied to a limited number of non-aflatoxigenic strains of A. flavus and that it was not our goal to study barcoding sequences, our results strengthen the hypothesis that the ITS region is suitable for the identification of A. flavus isolates.

Analysis of deletions within the aflatoxin biosynthesis gene cluster for the fifteen Iranian non-aflatoxigenic strains of A. flavus revealed that A. flavus strains had different deletions in the aflatoxin gene cluster. The detection of mycotoxigenic fungi has relied, for the most part, on the time consuming isolation and culturing techniques that require taxonomical expertise (Bhatnagar et al. 2006). The non-aflatoxigenic strains of A. flavus lacked 3-5 different genes (the aflatoxigenic strain of A. flavus used as a positive control had all of the genes). The deletion patterns observed in this study have not been previously reported. Some researchers reported that the analysis of deletion patterns in aflatoxin gene cluster was a useful marker for the identification of non-aflatoxigenic strains (Kusumoto et al. 2000, Ehrlich et al. 2005).

The variable amplicons of genes from aflatoxin biosynthesis gene cluster were produced by the non-aflatoxigenic strains of A. flavus from pistachio (10, 11, 13 & 14), maize (10, 12 & 13) and peanut (12 & 13), soil and kernels. The pksAaflT and omtB amplicons were not detected in pistachio non-aflatoxigenic strains of A. flavus. The only product amplified in the fifteen strains of A. flavus was C3 which belonged to pistachio strains. The C3 is the sugar utilization genes in the flanking region of the aflatoxin gene cluster. Donner et al. (2010) suggested that remnants of the aflatoxin gene cluster are not necessary for the isolates to exclude aflatoxin producers during the host infection, effectively. The genes ver-1nor-1ordAomtA and glcA were present in all of the non-aflatoxigenic strains. The glcA is a gene in the sugar utilization cluster adjacent to the 3´end of the aflatoxin cluster.

Scherm et al. (2005) studied 13 strains of A. parasiticus and/or A. flavus and found consistency of aflDaflO and aflP genes in detecting AF production ability, further indicating them as potential markers. The aflD gene encodes an enzyme that catalyzes the conversion of the first stable aflatoxin biosynthesis intermediate, norsolorinic acid to averantin in A. flavus (Papa 1982), while the aflQ gene is involved in the conversion of O-methylsterigmatocystin (omst) to aflatoxin B1 (AFB1) and aflatoxin G1 (AFG2), and also dihydro-O-methylsterigmatocystin (dmdhst) to aflatoxin B2 (AFB2) and aflatoxin G2 (AFG2) in A. parasiticus (Cleavland 1989) and A. flavus (Yu et al. 1998). It was assumed that the lack of amplicons revealed an evidence of the genetic variability for non-aflatoxigenic strains of A. flavus. It should be noted that aflatoxin biosynthesis pathway is highly complex, and just the key genes directly related to aflatoxin biosynthesis are useful for analyses of aflatoxin gene cluster. Therefore, the genes encoding the key enzymes necessary for aflatoxin production are used in this study.

It was assumed that non-aflatoxigenicity of our A. flavus strains might be associated with no DNA amplification. In the other words, the lack of aflatoxin production in the strains of A. flavus may be due to the lack of genes in their genome. Deletion of portions of the aflatoxin biosynthesis gene cluster within atoxigenic A. flavus strain is not rare (Chang et al. 2005). The loss of aflatoxin production by Iranian non-aflatoxigenic strains of A. flavus is not well understood. It should be considered that the lack of AFB production in non-aflatoxigenic strains of A. flavus does not clearly specify that their inability is only due to the partial loss of aflatoxin gene cluster (small deletions). Our findings should be demonstrated by other molecular methods as well as positive-negative PCR. For example, although A. oryzae strains have the aflatoxin biosynthesis gene cluster, it is not functional (Tominaga et al. 2006). Several reports have demonstrated that the risk of loss of gene, DNA recombinations, DNA inversions, partial deletions, translocations and other genomic disorders in the aflatoxin gene cluster are associated with proximity to the telomere region of fungal chromosome (Carbone et al. 2007). The aflatoxin biosynthesis genes in A. oryzae contain deletions, frame-shift mutations and base pair substitutions that explain the lack of aflatoxin production (Tominaga et al. 2006). Until recently, there have been very few verifiable reports of deletion patterns from aflatoxin biosynthesis gene cluster in the Iranian non-aflatoxigenic strains of A. flavus. Chang et al. (2005) reported eight deletion patterns (A to H) in the aflatoxin genes of 38 non-aflatoxigenic strains of A. flavus. They supported the hypothesis that deal with the relationship between the inability to produce aflatoxin and a partial or entire gene deletion or mutations in the aflatoxin gene cluster of non-aflatoxigenic strains of A. flavus. Criseo et al. (2001) reported that 85 of 134 non-aflatoxigenic strains of A. flavus had numerous deletions in aflatoxin gene cluster. Yin et al. (2009) showed that 24 of 35 isolates containing no detectable aflatoxins had the entire aflatoxin gene cluster. Eleven non-aflatoxigenic isolates had five different deletion patterns in the cluster. Mauro et al. (2013) detected six deletion patterns in the aflatoxin biosynthesis gene cluster of Italian non-aflatoxigenic strains of A. flavus. No deletions in the cluster were detected for twelve non-aflatoxigenic isolates and ten had the entire cluster deleted.

The presence of two strategic genes of the AF biosynthetic pathway, aflR and aflJ was associated with the aflatoxigenic ability of our isolates. Our findings revealed that aflatoxin biosynthesis regulatory genes (aflR and aflJ) and the structural gene hypA are more important genes to detect and identify Iranian non-aflatoxigenic strains of A. flavus.

The aflR and aflJ genes play an important role in the aflatoxin biosynthetic pathway by regulating the activity of other structural genes such as omt-Aver-1 and nor-1 (Bennett & Klich 2003, Yu et al. 2005).

The aflJ gene which is adjacent to aflR is necessary for expression of other genes in the aflatoxin cluster (Chang 2003). However, these findings are not according to some reports. These reports indicated that aflR gene could not distinguish and differentiate between aflatoxigenic and non-aflatoxigenic strains of A. flavus (Rodrigues et al. 2009). Gallo et al. (2012) studied the two regulatory genes (aflR and aflJ) and five structural genes (aflDaflMaflOaflP and aflQ) of non-aflatoxigenic strains of A. flavus from maize, and reported four different groups (I-IV) based on the gene amplification patterns. Erami et al. (2007) differentiated the aflatoxigenic strains among fourteen A. flavus strains using three structural genes ver-1nor-1, omt-1 and one aflatoxin biosynthesis regulatory gene (aflR). Other reports suggest that DNA banding patterns of non-aflatoxigenic strains of A. flavus are variable based on lack of the genes aflPaflMaflD and aflR (Criseo et al. 2008). Kale et al. (2007) showed that the regulation of aflatoxin biosynthesis in some strains of A. parasiticus was not due to lack of defects in three aflatoxin regulatory genes aflRaflJ and laeA. It is likely that secondary metabolic pathways in these types of A. parasiticus strains were not associated with aflR and aflJ genes and were independent of other aflatoxin positive regulators. So far, the molecular mechanisms responsible for the lack of aflatoxin production in some strains of A. flavus have not been known (Schmidt-Heydt et al. 2009).

In addition, the norB and cypA (norB-cypA intergenic region) amplicons were not detected in peanut strains of A. flavus. Yin et al. (2009) showed that fragments 0.3 and 0.8 kbp were amplified in fifteen A. flavus strains by the primer pair norB-cypA-F/norB–cypA-R.

Products from verA and norA were amplified from peanut strains of A. flavus. The hypA amplicon was detected in almost all the non-aflatoxigenic strains of A. flavus (except for pistachio strains IRP049 and IRP107).The hypA is a gene adjacent to sugar utilization genes in the flanking regions and adjacent to the 3´end of the aflatoxin gene cluster. Ehrlich et al. (2005) showed that the sugar utilization gene cluster on the right side of the aflatoxin gene cluster is well-conserved.

In the current study, some isolates belonging to different VCGs had identical deletion patterns and were closely related. Most of the non-aflatoxigenic strains of the examined VCGs of A. flavus produced amplicons for each of the aflatoxin biosynthesis genes examined. In nature, VCGs largely behave as clonal lineages (Ehrlich et al. 2007).

As a result of this study, the basis is provided for initial selection of endemic non-aflatoxigenic strains of A. flavus for biological control of aflatoxin contamination in Iran.

 

CONCLUSION

 

An attempt has been made in this study to highlight that PCR-based methods have provided a rapid and effective method for identification of genes potentially involved in aflatoxin formation and detection of non-aflatoxigenic fungus A. flavus for researchers. But, AF biosynthesis is based on a highly complex pathway. It is thus not surprising that genetic protocols that able to fully differentiate between AF producers and non-producers have not yet been successfully established.

The use of conventional PCR, utilizing primers targeting the aflR, aflJ and hypA genes appears to offer some promise in detecting Iranian non-aflatoxigenic strains of A. flavus, particularly with respect to the ability to distinguish characteristic DNA banding patterns derived from amplicons of appropriate size.

Since the A. flavus strains used in this study were all non-aflatoxigenic, we consider that more strains of the species A. flavus, which is extremely variable in terms of AF production need to be tested in order to guarantee the ability of aflR, aflJ and hypA to be used as a molecular marker for this characteristic. Considering the potential role that the aflatoxin biosynthesis gene cluster has in the aflatoxigenic strains of A. flavus, studying the genes in aflatoxin non-producing strains of A. flavus collected from different regions and substrates (soil and kernel) may provide insights into the significance of these genes for the aflatoxigenicity of the A. flavus isolates.

The present work is far from being a finished business, and a lot of windows have been left open.

 

ACKNOWLEDGEMENTS

 

Authors feel pleasure in expressing their grateful thanks to anonymous reviewers for their insightful comments and suggestions that helped us improve this manuscript. This study was funded by the Ferdowsi University of Mashhad, Iran. 

 
Baird RE, Trigiano RN, Windham G, Williams P, Kelley R, Abbas HK, Moulton JK, Scruggs ML. 2006. Comparison of aflatoxigenic and non-aflatoxigenic isolates of Aspergillus flavus using DNA amplification fingerprinting techniques. Mycopathologia 161: 93-99.

Bennett JW, Klich M. 2003. MycotoxinsClinical Microbiology Reviews 16: 497-516.

Bhatnagar D, Cary JW, Ehrlich K, Yu J, Cleveland TE. 2006. Understanding the genetics of regulation of aflatoxin production and Aspergillus flavus development. Mycopathologia 162: 155–166.

Brown DW, Yu JH, Kelkar HS, Fernandes M, Nesbitt TC, Keller NP, Adams TH, Leonard TJ. 1996. Twenty-five co-regulated transcripts define a sterigmatocystin gene cluster in Aspergillus nidulans. Proceedings of the National Academy of Sciences of United States of America 93: 1418-1422.

Bragulat MR, Abarca ML, Cabañes FJ. 2001. An easy screening method for fungi producing ochratoxin A in pure culture. International Journal of Food Microbiology 71: 139–144.

Carbone I, Ramirez-PradoJH, JakobekJL, Horn BW. 2007. Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster. BMC Evolutionary Biology 7: 111.

Cary JW, Ehrlich KC. 2006. Aflatoxigenicity in Aspergillus: Molecular genetics, phylogenetic relationships and evolutionary implications. Mycopathologia 162: 167-177.

Chang PK. 2003. The Aspergillus parasiticus protein AFLJ interacts with the aflatoxin pathway-specific regulator AFLR. Molecular Genetics and Genomics 268: 711–719.

Chang PK, Horn BW, DornerJW. 2005. Sequence breakpoints in the aflatoxin biosynthesis gene cluster and flanking regions in non-aflatoxigenic Aspergillus flavus isolates. Fungal Genetics and Biology 42: 914–923.

Chang PK, YuJ, Ehrlich KC, Boue SM, Montalbano BG. 2000. adhA in Aspergillus parasiticus is involved in conversion of 5′-hydroxyaverantin to averufin. Applied and Environmental Microbiology 66: 4715–4719.

Chang PK, Ehrlich KC, Hua SST. 2006. Cladal relatedness among Aspergillus oryzae isolates and Aspergillus flavus S and L morphotype isolates. International Journal of Food Microbiology108: 172-177.

Chang PK, Wilkinson JR, Horn BW, Yu J, Bhatnagar D, Cleveland TE. 2007. Genes differentially expressed by Aspergillus flavus strains after loss of aflatoxin production by serial transfers. Applied Microbiology and Biotechnology 77: 917-925.

Chen RS, Tsay JG, Huang YF, Chiou RYY. 2002. Polymerase chain reaction-mediated characterization of molds belonging to the Aspergillus flavus group and detection of Aspergillus parasiticus in peanut kernels by a multiplex polymerase chain reaction. Journal of Food Protection 65: 840–844.

Cheraghali AM, Yazdanpanah H, Doraki N, Abouhossain G, Hassibi M, Aliabadi S, Aliakbarpoor M, Amirahmadi M, Askarian A, Fallah N, Hashemi T, Jalali M, Kalantari N, Khodadadi E, Maddah B, Mohit R, Mohseny M, Phaghihy Z, Rahmani A, Setoodeh L, Soleimany E, Zamanian F. 2007. Incidence of aflatoxins in Iran pistachio nuts. Food and Chemical Toxicology 45:812-816.

Cleveland TE. 1989. Conversion of dihydro-O-methylsterigmatocystin to aflatoxin B2 by Aspergillus parasiticus. Archives of Environmental Contamination and Toxicology18: 429–433.

Criseo G, Bagnara A, Bisignano G. 2001. Differentiation of aflatoxin-producing and non-producing strains of Aspergillus flavus group. Letters in Applied Microbiology 33: 291-295.

Criseo G, Racco C, Romeo O. 2008. High genetic variability in non-aflatoxigenic A. flavus strains by using Quadruplex PCR-based assay. International Journal of Food Microbiology 125:341-343.

Donner M, Atenhkeng J, Sikora RA, Bandyopadhyay R, Cotty PJ. 2010. Molecular characterization of atoxigenic strains for biological control of aflatoxins in Nigeria. Food Additives & Contaminants. 27: 576-590.

Erami M, Hashemi SJ, Pourbakhsh SA,Shahsavandi S, Mohammadi S, Shooshtari AH, Jahanshiri Z. 2007. Application of PCR on detection of aflatoxinogenic molds. Archives of Razi Institute 62: 95-100.

Ehrlich KC, Cotty PJ. 2004. An isolate of Aspergillus flavus used to reduce aflatoxin contamination in cottonseed has a defective polyketide synthase gene. Applied Microbiology and Biotechnology 65: 473-478.

Ehrlich KC, Chang PK, Yu J, Cotty PJ. 2004. Aflatoxin biosynthesis cluster gene cypA is required for G aflatoxin formation. Applied and Environmental Microbiology70: 6518–6524.

Ehrlich KC, Yu J, Cotty PJ. 2005. Aflatoxin biosynthesis gene clusters and flanking regions. Journal of Applied Microbiology 99: 518-527.

Ehrlich KC, Kobbeman K, Montalbano BG, Cotty PJ. 2007. Aflatoxin-producing Aspergillus species from Thailand. International Journal of Food Microbiology 114: 153–159.

Färber P, Geisen R, Holzapfel WH. 1997. Detection of aflatoxigenic fungi in figs by a PCR reaction. International Journal of Food Microbiology 36: 215-220.

Fente CA, Jaimez OJ, Vazquez BI, Franco CM, Cepeda A. 2001. A new additive for culture media for rapid determination of aflatoxin-producing Aspergilli strains. Applied and Environmental Microbiology 67: 4858–4862.

Gallo A, Stea G, Battilani P, Logrieco AF, Perrone G. 2012. Molecular characterization of an Aspergillus flavus population isolated from maize during the first outbreak of aflatoxin contamination in Italy. Phytopathologia Mediterranea 51: 198-206.

Geisen R. 1996. Multiplex polymerase chain reaction for the detection of potential aflatoxin and sterigmatocystin producing fungi. Systematic and Applied Microbiology 19: 388-392.

Ghiasian SA, Shephard GS, Yazdanpanah H. 2011. Natural occurrence of aflatoxins from maize in Iran. Mycopathologia 172: 153-160.

Hedayati MT, Kaboli S, Mayahi S. 2010. Mycoflora of pistachio and peanut kernels from Sari, Iran. Jundishapur Journal of Microbiology 3: 114-20.

Houshyarfard M, Rouhani H, Falahati-Rastegar M, Malekzadeh-Shafaroudi S, Mehdikhani-Moghaddam E. In press. Characterization of Iranian non-aflatoxigenic strains of Aspergillus flavus based on microsatellite-primed PCR. Molecular Biology Research Communications.

Kale SP, Cary JW, Hollis N, Wilkinson JR, Bhatnagar D, Yu J, Cleveland TE, Bennett JW. 2007. Analysis of aflatoxin regulatory factors in serial transfer-induced non-aflatoxigenic Aspergillus parasiticus. Food Additives and Food Contaminants 24: 1061-1069.

Keller NP, Turnerand G, Bennett JW. 2005. Fungal secondary metabolism from biochemistry to genomics. Nature Reviews Microbiology 3: 937–947.

Klich MA. 2002. Identification of common Aspergillus species. American Society for Microbiology, USA.

Kusumoto K, Nogata Y, Ohta H. 2000. Directed deletions in the aflatoxin biosynthesis gene homolog cluster of Aspergillus oryzae. Current Genetics 37:104–111.

Lee CZ, Liou GY & Yuan GF. 2006. Comparison of the aflR gene sequences of strains in Aspergillus section Flavi. Microbiology 152: 161-170.

Levin RE. 2012. PCR detection of aflatoxin producing fungi and its limitations. International Journal of Food Microbiology 156: 1–6.

Mauro A, Battilani P, Callicott KA, Giorni P, Pietri A, Cotty PJ. 2013. Structure of an Aspergillus flavus population from maize kernels in northern Italy. International Journal of Food Microbiology 162: 1–7.

Mayer Z, Farber P, Geisen R. 2003. Monitoring the production of aflatoxin B1 in wheat by measuring the concentration of nor-1 mRNA. Applied and Environmental Microbiology 69: 1154–1158.

Motomura M, Chihaya N, Shinozawa T, Hamasaki T, Yabe K. 1999. Cloning and characterization of the O-methyltransferase I gene (dmtA) from Aspergillus parasiticus associated with the conversions of demethylsterigmatocystin to sterigmatocystin and dihydrodemethylsterigmatocystin to dihydrosteri-
gmatocystin in aflatoxin biosynthesis. Applied and Environmental Microbiology 65: 4987–4994.

Okoth S, Nyongesa B, Ayugi V, Kang'ethe E, Korhonen H, Joutsjoki V. 2012. Toxigenic potential of Aspergillus species occurring on maize kernels from two agro-ecological zones in Kenya. Toxins 4: 991-1007.

Papa KE. 1982. Norsolorinic acid mutant of Aspergillus flavus. Journal of General Microbiology 128: 1345–1348.

Pildain MB, Frisvad JC, Vaamonde G, Cabral D, Varga J, Samson RA. 2008. Two novel aflatoxin-producing Aspergillus species from Argentinean peanuts. International Journal of Systematic and Evolutionary Microbiology 58: 725–735.

Prabha TR, Revathi K, Vinod MS, Shanthakumar SP, Bernard P. 2013. A simple method for total genomic DNA extraction from water moulds. Current Science 104: 345-347.

Prieto R, Yousibova GL, Woloshuk CP. 1996 Identification of aflatoxin biosynthesis genes by genetic complementation in an Aspergillus flavus mutant lacking the aflatoxin gene cluster. Applied and Environmental Microbiology 62: 3567–3571.

Rahimi P, Sharifnabi B, Bahar M. 2008. Detection of aflatoxin in Aspergillus species isolated from pistachio in Iran. Journal of Phytopathology 156: 15–20.

Rodrigues P, Venâncio A, Kozakiewicz Z, Lima N. 2009. A polyphasic approach to the identification of aflatoxigenic and non-aflatoxigenic strains of Aspergillus section Flavi isolated from Portuguese almonds. International Journal of Food Microbiology 129: 187-193.

Samson RA, Hong SB, Frisvad JC. 2006. Old and new concepts for species differentiation in Aspergillus. Medical Mycology.44: 133-148.

Samson RA, Hoekstra ES, Lund O, Filtenborg O, Frisvad JC. 2004. Methods for the detection, isolation and characterisation of food-borne fungi. In: Introduction to food and airborne fungi, (Samson RA, Hoekstra ES & Frisvad JC, eds): 283-305. Wageningen: CBS, Netherlands.

Sardiñas N, Vázquez C, Gil-Serna J, Gonzaléz-JaénMT, Patiño, B. 2011. Specific detection and quantification of Aspergilus flavus and A. parasiticus in wheat flour by SIBR® Green quantitative PCR. International Journal of Food Microbiology 145: 121-125.

Scherm B, Palomba M, Serra D, Marcello A, Migheli Q. 2005. Detection of transcripts of the aflatoxin genes aflDaflO, and aflP by reverse transcription-polymerase chain reactions allows differentiation of aflatoxin-producing and non-producing isolates of Aspergillus flavus and Aspergillus parasiticus. International Journal of Food Microbiology 98: 201–210.

Schmidt-Heydt M, Abdel-Hadi A, Magan N, Geisen R. 2009. Complex regulation of the aflatoxin biosynthesis gene cluster of Aspergillus flavus in relation to various combinations of water activity and temperature. International Journal of Food Microbiology 135: 231-237.

Shapira R, Paster N, Eyal O, Menasherov M, Mett A, Salomon R. 1996. Detection of aflatoxigenic molds in grains by PCR. Applied and Environmental Microbiology 62: 3270–3273.

Tominaga M, Lee YH, Hayashi R, Suzuki Y, Yamada O, Sakamoto K, Gotoh K, Akita O. 2006. Molecular analysis of an inactive aflatoxin biosynthesis gene cluster in Aspergillus oryzae RIB strains. Applied and Environmental Microbiology 72: 484–490.

Wen Y, Hatabayashi H, Arai H, Kitamoto HK, Yabe K. 2005. Function of the cypX and moxY genes in aflatoxin biosynthesis in Aspergillus parasiticus. Applied and Environmental Microbiology 71: 3192-3198.

Yabe K & Nakajima H. 2004. Enzyme reactions and genes in aflatoxin biosynthesis. Applied Microbiology and Biotechnology 64: 745-755.

Yin YN, Yan LY, Jiang JH, & MaZH. 2008. Biological control of aflatoxin contamination of crops. Journal of Zhejiang University Science 9: 787-792.

Yin Y, Lou T, Yan L, Michailides TJ, Ma Z. 2009. Molecular characterization of toxigenic and atoxigenic Aspergillus flavus isolates, collected from peanut fields in China. Journal of Applied Microbiology 107: 1857-1865.

Yu J, Chang PK, Cary JW, Ehrlich KC, Montalbano B, Dyer JM, Bhatnagar D, Cleveland TE. 1998. Characterization of the critical amino acids of an Aspergillus parasiticus cytochrome P450 monooxygenase encoded by ordA involved in aflatoxin B1, G1, B2, and G2 biosynthesis. Applied and Environmental Microbiology 64: 4834–4841.

Yu J, Woloshuk CP, Bhatnagar D, Cleveland TE. 2000. Cloning and characterization of avfA and omtB genes involved in aflatoxin biosynthesis in three Aspergillus species. Gene 248: 157–167.

Yu J., Chang P-K, Ehrlich KC, Cary JW, Bhatnagar D, Cleveland TE, Payne G. A, Linz JE, Woloshuk CP, Bennett JW. 2004. Clustered pathway genes in aflatoxin biosynthesis. Applied and Environmental Microbiology 70: 1253-1262.

Yu J, Cleveland TE, Nierman WC, Bennet JW. 2005. Aspergillus flavus genomics: gateway to human animal health, food safety, and crop resistance to diseases. Revista Iberoamericanade Micologia 22: 194-202.